Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-656-3p URS0000202460_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-656: Hsa-mir-656 is a microRNA that has been studied in various contexts. It has been obtained from Dharmacon and used in experiments involving co-transfection with other microRNA mimics and inhibitors [PMC3486798]. However, when hsa-mir-656 or hsa-miR-877-5p were transfected, there was no change in luciferase activity [PMC3486798]. It was initially anticipated that hsa-mir-656 would only interact with the CBR1 3'-UTR in its rs9024 polymorphic state, but no binding capacity was observed [PMC3486798]. Bioinformatic predictions identified hsa-mir-656 as a potential candidate for interacting with the 3'-UTR of CBR1, but it had no effect on CBR1 expression or activity [PMC3486798]. Hsa-mir-656 has also been predicted to target multiple genes, including EPS15 [PMC4838358]. In glioma, hsa-mir-656 expression levels are downregulated and it inhibits neurosphere formation and cell proliferation by targeting BMPR1A [PMC5260001]. Hsa-mir-656 has also been found to play a potential role in GBM progression [PMC5260001]. Additionally, changes in expression patterns of hsa-miR-92b, hsa-miR-137, hsa-mir-656, and other miRNAs were observed after exposure to low and high doses of X-ray radiation [PMC3424689]. Hsa-mir-656 is part of an imprinted DLK-DIO3 region that comprises multiple miRNA genes [PMC3563971].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUAUUAUACAGUCAACCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus bta-miR-656
  2. Canis lupus familiaris Cfa-Mir-154-P25_3p (mature (guide))
  3. Capra hircus (goat) chi-miR-656
  4. Cavia porcellus cpo-miR-656-3p
  5. Cervus elaphus (red deer) cel-miR-656
  6. Dasypus novemcinctus dno-miR-656-3p
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P25_3p (mature (guide))
  8. Equus caballus eca-miR-656
  9. Macaca mulatta mml-miR-656-3p
  10. Oryctolagus cuniculus ocu-miR-656-3p
  11. Pan troglodytes (chimpanzee) ptr-miR-656
  12. Pongo pygmaeus ppy-miR-656
  13. Pteropus alecto pal-miR-656-3p
  14. Sus scrofa ssc-mir9
  15. Tupaia chinensis tch-miR-656
Publications