Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-381-3p URS00001FFA8C_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (MirGeneDB, TarBase, GeneCards, RefSeq, MalaCards, miRBase, ENA). Described in 43 papers. Homo sapiens (human) hsa-miR-381-3p sequence is a product of RG-12, MIR381, hsa-miR-381, miR-381-3p, hsa-miR-381-3p, hsa-RG-12, miR-381 genes. Found in the human reference genome. Interacts with protein-coding genes, including ACTG, ACTG1, ACTR3, ALS20, ANCR, ANGEL2, APRIN, APRO2, ARHGAP11A, ARHGEF2.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUACAAGGGCAAGCUCUCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 21 other species

    1. Bos taurus bta-miR-381
    2. Callithrix jacchus cja-miR-381
    3. Canis lupus familiaris (dog) cfa-miR-381
    4. Capra hircus (goat) chi-miR-381
    5. Cavia porcellus cpo-miR-381-3p
    6. Cricetulus griseus cgr-miR-381
    7. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-154-P9_3p (mature (guide))
    8. Daubentonia madagascariensis (aye-aye) dma-miR-381
    9. Echinops telfairi Ete-Mir-154-P9_3p (mature (guide))
    10. Equus caballus eca-miR-381
    11. Macaca mulatta (Rhesus monkey) mml-miR-381-3p
    12. Microcebus murinus mmr-miR-381
    13. Mus musculus (house mouse) mmu-miR-381-3p
    14. Nomascus leucogenys nle-miR-381
    15. Oryctolagus cuniculus (rabbit) ocu-miR-381-3p
    16. Otolemur garnettii oga-miR-381
    17. Pan paniscus (pygmy chimpanzee) ppa-miR-381
    18. Pan troglodytes (chimpanzee) ptr-miR-381
    19. Papio hamadryas (hamadryas baboon) pha-miR-381
    20. Pongo pygmaeus ppy-miR-381
    21. Rattus norvegicus (Norway rat) Rno-Mir-154-P9_3p (mature (guide))
    22. Tupaia chinensis tch-miR-381-3p