v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila pseudoobscura dps-miR-987-5p URS00001F70B9_7237

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAAAGUAAAUAGUCUGGAUUGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-987
  2. Cochliomyia macellaria mature cma-miR-987
  3. Drosophila melanogaster (fruit fly) dme-miR-987-5p
  4. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0330839_df_nrg
  5. Drosophila yakuba Drosophila_yakuba piRNA piR-dya-488766