Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-449a URS00001F5B39_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-449a: Hsa-mir-449a, a microRNA studied in relation to male fertility, has been found to have the highest levels of expression among the three miRNAs studied, with an average expression level of 0.98 ± 0.3 [PMC7851476]. Additional research has identified 182 candidate circRNAs for hsa-mir-449a and 192 candidate circRNAs for hsa-miR-34c-5p [PMC9063222]. Furthermore, a dual-luciferase reporter gene assay confirmed that TIMM8A is a direct target gene of hsa-mir-449a and hsa-miR-34c-5p [PMC9063222]. These findings suggest that hsa-mir-449a may play a significant role in fertility and may interact with circRNAs and target genes such as TIMM8A. Further research is needed to fully understand the mechanisms and implications of these interactions.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAGUGUAUUGUUAGCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus (cattle) bta-miR-449a
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-449a
  3. Canis lupus familiaris cfa-miR-449a
  4. Cavia porcellus (domestic guinea pig) cpo-miR-449a-5p
  5. Cervus elaphus cel-miR-449a
  6. Cricetulus griseus cgr-miR-449a
  7. Dasypus novemcinctus dno-miR-449a-5p
  8. Echinops telfairi Ete-Mir-34-P3c_5p (mature (guide))
  9. Equus caballus eca-miR-449a
  10. Macaca mulatta mml-miR-449a-5p
  11. Monodelphis domestica (gray short-tailed opossum) mdo-miR-449a-5p
  12. Mus musculus mmu-miR-449a-5p
  13. Oryctolagus cuniculus ocu-miR-449a-5p
  14. Pongo pygmaeus ppy-miR-449a
  15. Pteropus alecto pal-miR-449a-5p
  16. Rattus norvegicus (Norway rat) rno-miR-449a-5p
  17. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P3c_5p (mature (guide))
Publications