Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-449a URS00001F5B39_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MirGeneDB, TarBase, IntAct, GeneCards, RefSeq, MalaCards, LncBase, miRBase, ENA). Described in 59 papers. Homo sapiens (human) hsa-miR-449a sequence is a product of hsa-miR-449a, miR-449, MIR449A, miR-449a genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3GAMMA, 14-3-3γ, 156DAG, 16E1BP, 37LRP, 4.1-G, 4.1G, A20, A2ML1, A3a.

Interactions 2

According to IntAct, Homo sapiens (human) hsa-miR-449a interacts with:

IntAct ID Participant Synonyms
EBI-11785321 intact:EBI-11709120 EBI-11709120 lnc_arsr
EBI-11709687 intact:EBI-11709120 EBI-11709120 lnc_arsr

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGCAGUGUAUUGUUAGCUGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Bos taurus bta-miR-449a
    2. Callithrix jacchus cja-miR-449a
    3. Canis lupus familiaris (dog) cfa-miR-449a
    4. Cavia porcellus cpo-miR-449a-5p
    5. Cervus elaphus cel-miR-449a
    6. Cricetulus griseus cgr-miR-449a
    7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-449a-5p
    8. Echinops telfairi Ete-Mir-34-P3a_5p (mature (guide))
    9. Equus caballus eca-miR-449a
    10. Macaca mulatta (Rhesus monkey) mml-miR-449a-5p
    11. Monodelphis domestica mdo-miR-449a-5p
    12. Mus musculus (house mouse) mmu-miR-449a-5p
    13. Oryctolagus cuniculus (rabbit) ocu-miR-449a-5p
    14. Pongo pygmaeus ppy-miR-449a
    15. Pteropus alecto (black flying fox) pal-miR-449a-5p
    16. Rattus norvegicus (Norway rat) rno-miR-449a-5p
    17. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P3a_5p (mature (guide))