Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-449a-5p URS00001F5B39_10090

Automated summary: This piRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 6 databases (RefSeq, miRBase, PirBase, ENA, TarBase, MirGeneDB). Described in 30 papers. Mus musculus (house mouse) mmu-miR-449a-5p sequence is a product of mmu-miR-449a-5p, miR-449, mmu-miR-449a, miR-449a-5p, miR-449a, Mir449a genes. Interacts with protein-coding genes, including 0610007A03Rik, 0610007D13Rik, 0610009H19Rik, 0610009M14Rik, 0610016L08Rik, 0610030G24Rik, 0610033N24Rik, 0610040D20Rik, 0610040O15Rik, 0710001E13Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGCAGUGUAUUGUUAGCUGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Bos taurus bta-miR-449a
    2. Callithrix jacchus cja-miR-449a
    3. Canis lupus familiaris (dog) cfa-miR-449a
    4. Cavia porcellus cpo-miR-449a-5p
    5. Cervus elaphus cel-miR-449a
    6. Cricetulus griseus cgr-miR-449a
    7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-449a-5p
    8. Echinops telfairi Ete-Mir-34-P3a_5p (mature (guide))
    9. Equus caballus eca-miR-449a
    10. Homo sapiens hsa-miR-449a
    11. Macaca mulatta (Rhesus monkey) mml-miR-449a-5p
    12. Monodelphis domestica mdo-miR-449a-5p
    13. Oryctolagus cuniculus (rabbit) ocu-miR-449a-5p
    14. Pongo pygmaeus ppy-miR-449a
    15. Pteropus alecto (black flying fox) pal-miR-449a-5p
    16. Rattus norvegicus (Norway rat) rno-miR-449a-5p
    17. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P3a_5p (mature (guide))