Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-126a-3p URS00001F1DA8_10090

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGUACCGUGAGUAAUAAUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Alligator mississippiensis ami-miR-126-3p
  2. Anolis carolinensis (green anole) aca-miR-126-3p
  3. Bos taurus (cattle) Bta-Mir-126-P2-v1_3p (mature (guide))
  4. Callithrix jacchus cja-miR-126
  5. Canis lupus familiaris Cfa-Mir-126-P2-v1_3p (mature (guide))
  6. Cavia porcellus (domestic guinea pig) cpo-miR-126-3p
  7. Cervus elaphus (red deer) cel-miR-126
  8. Chrysemys picta bellii Cpi-Mir-126-P2-v1_3p (mature (guide))
  9. Chrysemys picta cpi-miR-126-3p
  10. Columba livia (rock pigeon) cli-miR-126-3p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-126a
  12. Dasypus novemcinctus dno-miR-126-3p
  13. Echinops telfairi Ete-Mir-126-P2-v1_3p (mature (guide))
  14. Equus caballus (horse) eca-miR-126-3p
  15. Gallus gallus (chicken) Gga-Mir-126-P2-v1_3p (mature (guide))
  16. Gekko japonicus Gja-Mir-126-P2-v1_3p (mature (guide))
  17. Homo sapiens (human) hsa-miR-126-3p
  18. Latimeria chalumnae Lch-Mir-126-P2_3p (mature (guide))
  19. Macaca mulatta mml-miR-126
  20. Microcaecilia unicolor Mun-Mir-126-P2-v1_3p (mature (guide))
  21. Monodelphis domestica mdo-miR-126-3p
  22. Ornithorhynchus anatinus (platypus) oan-miR-126-3p
  23. Oryctolagus cuniculus Ocu-Mir-126-P2-v1_3p (mature (guide))
  24. Pan troglodytes ptr-miR-126
  25. Pongo pygmaeus (Bornean orangutan) ppy-miR-126
  26. Python bivittatus (Burmese python) pbv-miR-126-3p
  27. Rattus norvegicus (Norway rat) rno-miR-126a-3p
  28. Sarcophilus harrisii Sha-Mir-126-P2-v1_3p (mature (guide))
  29. Sphenodon punctatus Spt-Mir-126-P2_3p (mature (guide))
  30. Sus scrofa (pig) ssc-miR-126-3p
  31. Taeniopygia guttata tgu-miR-126-3p
  32. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-126-P2-v1_3p (mature (guide))
Publications