Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-126-3p URS00001F1DA8_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, RefSeq, TarBase, GeneCards, MirGeneDB, ENA, miRBase, LncBase). Described in 81 papers. Homo sapiens (human) hsa-miR-126-3p sequence is a product of hsa-miR-126-3p, MIR126, miR-126, hsa-miR-126, miR-126-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 2F1, 3-10C, 5-HT2A, 53BP1, 6-16, 60B8AG, 7h3, A-SCID, A170, A26C2.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCGUACCGUGAGUAAUAAUGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Alligator mississippiensis (American alligator) ami-miR-126-3p
    2. Anolis carolinensis aca-miR-126-3p
    3. Bos taurus Bta-Mir-126-v2_3p (mature (guide))
    4. Callithrix jacchus cja-miR-126
    5. Canis lupus familiaris (dog) Cfa-Mir-126-v2_3p (mature (guide))
    6. Cavia porcellus cpo-miR-126-3p
    7. Cervus elaphus cel-miR-126
    8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-126-v2_3p (mature (guide))
    9. Chrysemys picta (Painted turtle) cpi-miR-126-3p
    10. Columba livia (rock pigeon) cli-miR-126-3p
    11. Cricetulus griseus cgr-miR-126a
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-126-3p
    13. Echinops telfairi Ete-Mir-126-v2_3p (mature (guide))
    14. Equus caballus eca-miR-126-3p
    15. Gallus gallus (chicken) Gga-Mir-126-v2_3p (mature (guide))
    16. Macaca mulatta (Rhesus monkey) mml-miR-126
    17. Monodelphis domestica mdo-miR-126-3p
    18. Mus musculus (house mouse) mmu-miR-126a-3p
    19. Ornithorhynchus anatinus (platypus) oan-miR-126-3p
    20. Oryctolagus cuniculus (rabbit) Ocu-Mir-126-v2_3p (mature (guide))
    21. Pan troglodytes (chimpanzee) ptr-miR-126
    22. Pongo pygmaeus ppy-miR-126
    23. Python bivittatus (Burmese python) pbv-miR-126-3p
    24. Rattus norvegicus (Norway rat) rno-miR-126a-3p
    25. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-126-v2_3p (mature (guide))
    26. Sus scrofa ssc-miR-126-3p
    27. Taeniopygia guttata tgu-miR-126-3p
    28. Xenopus tropicalis Xtr-Mir-126-v2_3p (mature (guide))