v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-125a-3p URS00001F0C23_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-125a: Hsa-mir-125a is a microRNA that plays a role in regulating gene expression. It has been found that a decrease in the level of hsa-mir-125a can lead to the promotion of ERBB2 mRNA decay and inhibition of translation [1] [PMC3573016]. However, the specific mechanism by which the rs12976445 variant affects the level of MIR125A is still unknown. It is unclear whether this variant affects transcriptional regulation, maturation, or transport of hsa-mir-125a [1] [PMC3573016]. In a study, predesigned Taqman microRNA assays were used to analyze various microRNAs including hsa-mir-125a [2] [PMC7560850]. These assays included specific primers and probe mixes for hsa-mir-125a and other microRNAs [2] [PMC7560850].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACAGGUGAGGUUCUUGGGAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-125a-3p
  2. Cervus elaphus (red deer) cel-miR-125a-3p
  3. Equus caballus (horse) eca-miR-125a-3p
  4. Macaca mulatta mml-miR-125a-3p
  5. Mus musculus (house mouse) mmu-miR-125a-3p
  6. Pan troglodytes ptr-miR-125a
  7. Pongo pygmaeus (Bornean orangutan) ppy-miR-125a-3p
  8. Rattus norvegicus (Norway rat) rno-miR-125a-3p
 Publications