Pongo pygmaeus (Bornean orangutan) ppy-miR-125a-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-125a-3p URS00001F0C23_9600

22 nucleotides
1 database (miRBase)
Found in 8 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

ACAGGUGAGGUUCUUGGGAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Cavia porcellus (domestic guinea pig) cpo-miR-125a-3p
Cervus elaphus (red deer) cel-miR-125a-3p
Equus caballus (horse) eca-miR-125a-3p
Homo sapiens (human) hsa-miR-125a-3p
Macaca mulatta mml-miR-125a-3p
Mus musculus (house mouse) mmu-miR-125a-3p
Pan troglodytes ptr-miR-125a
Rattus norvegicus (Norway rat) rno-miR-125a-3p