Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3118 URS00001EE4D9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-3118: Hsa-mir-3118 is a differentially expressed (DE) miRNA found in the blood of colorectal cancer patients who developed venous thromboembolism (VTE) [PMC9361765]. Rs7508 in the 3' untranslated region (3'UTR) of ASAH1 may affect the binding of hsa-mir-3118, along with other miRNAs [PMC7521544]. The expressions of 14 miRNAs, including hsa-mir-3118, located on chromosome 21 were evaluated [PMC4823505]. The normalization control used in this evaluation was u6-snRNA [PMC5863254]. Hsa-mir-3118 is partly derived from LINE/L1PA13, a type of transposable element (TE), and belongs to a large miRNA group called hsa-mir-548, which is derived from DNA/MADE1 element [PMC4482582]. The hsa-miR-548 family consists of 77 members derived from DNA_TcMar-Mariner/MADE1, while the 11 copies of hsa-miR-1302 are derived from DNA_hAT/MER53 [PMC9409130]. Four copies of hsa-mir-3118 are derived from different subfamilies within the LINE/L1 family: one from LINE_L1/L1PA12, two from LINE_L1/L1PA13, and one from LINE_L1/L1PA14 [PMC9409130].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGACUGCAUUAUGAAAAUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications