Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) testis expressed transcript, Y-linked 19 (TTTY19) URS00001ED146_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TTTY19: TTTY19 is a male-specific long non-coding RNA (lncRNA) that has been identified as one of the top 10 newly loaded lncRNAs after licensing [PMC9263655]. In bladder cancer (BLCA) patients, higher expression levels of TTTY19 were associated with longer survival [PMC7993680]. Additionally, patients with lower risk scores were more likely to have higher expression levels of TTTY19, suggesting its role as a suppressor lncRNA [PMC7993680]. A 10-lncRNA signature, including TTTY19, was found to have prognostic value in BLCA patients [PMC7993680]. The prognostic model constructed using the expression levels of these lncRNAs showed that lower expression levels of TTTY19 were associated with higher risk scores [PMC7993680]. Interestingly, TTTY19 is downregulated in BLCA [PMC7993680]. Despite being considered a male-specific lncRNA, there is limited research on TTTY19 available [PMC7993680]. In summary, TTTY19 is a male-specific lncRNA that has been identified as one of the top 10 newly loaded lncRNAs after licensing. In BLCA patients, higher expression levels of TTTY19 are associated with longer survival. It acts as a suppressor lncRNA and its downregulation is observed in BLCA. However, there is limited research available on this particular lncRNA.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACAGUCCCAUUGAGCAACACUUCAAUGAAUGCACCCCUCCAAAUUGAGAAGGCCAUGAAGAUGAAAUGAAAUAGUCUAGAUUCCCAGAUGAAGUUGCAAGACAUCUUCUACCCCUCAACAGACUGUAUCUUCACCUCUAUCUGACCUUAUUGCUGCUCACAUUAUUUGUCUCAAGAUAAAAUCCCAAAACUCUGGAGGGGUGCUGCCUCACAAGAUGCAUCACCUGCUCAGUUGGGAACCAAAUUUGAGGUAAAUUCAAGGUGCCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications