Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-187-3p URS00001EB9FC_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (RefSeq, GeneCards, LncBase, miRBase, ENA, PSICQUIC, TarBase, MalaCards, MirGeneDB). Described in 40 papers. Homo sapiens (human) hsa-miR-187-3p sequence is a product of miR-187-3p, hsa-miR-187, miR-187, MIR187, hsa-miR-187-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including ANKRD11, APRO5, ARHGAP5, ATP6D, ATP6DV, ATP6V0D1, AZ1, AZI, B4GALT7, BAZ1B.

Interactions 4

According to PSICQUIC, Homo sapiens (human) hsa-miR-187-3p interacts with:

Interaction id Participant Synonyms
URS00001EB9FC_9606-0 P01375 P01375
URS00001EB9FC_9606-2 P01375 P01375
URS00001EB9FC_9606-1 Q9BYH8 Q9BYH8
URS00001EB9FC_9606-3 Q9BYH8 Q9BYH8

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCGUGUCUUGUGUUGCAGCCGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 21 other species

    1. Bos taurus (cattle) bta-miR-187
    2. Callithrix jacchus cja-miR-187
    3. Canis lupus familiaris cfa-miR-187
    4. Cavia porcellus (domestic guinea pig) cpo-miR-187-3p
    5. Cervus elaphus (red deer) Cel-miR-187
    6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-187-3p
    7. Equus caballus (horse) eca-miR-187
    8. Macaca mulatta mml-miR-187-3p
    9. Mus musculus (house mouse) mmu-miR-187-3p
    10. Oryctolagus cuniculus (rabbit) ocu-miR-187-3p
    11. Pteropus alecto pal-miR-187-3p
    12. Rattus norvegicus rno-miR-187-3p
    13. Sus scrofa ssc-miR-187