Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-29b precursor (hsa-mir-29b-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-29b precursor (hsa-mir-29b-2) URS00001E96DA_9606

  • 81 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 48 species

Automated summary: This pre miRNA sequence is 81 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (miRBase, Ensembl/GENCODE, RefSeq, MalaCards, HGNC, ENA, Ensembl, GeneCards). Described in 40 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-29, RF00074). Homo sapiens (human) microRNA hsa-mir-29b precursor (hsa-mir-29b-2) sequence is a product of mir-29b-2, 2, mir-29b-2 precursor, mir-29b-2 precurso, hsa-mir-29b-2 precursor, miR-102-precursor-1, 29b-2, 102-precursor-1, MIR29B2 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 47 other species

    1. Ailuropoda melanoleuca (giant panda) miRNA
    2. Aotus nancymaae miRNA
    3. Artibeus jamaicensis microRNA aja-mir-29b precursor
    4. Bos taurus (cattle) microRNA bta-mir-29b precursor (bta-mir-29b-2)
    5. Capra hircus (Goat) chi-mir-29b
    6. Carlito syrichta (Philippine tarsier) miRNA
    7. Cercocebus atys (Sooty mangabey) miRNA
    8. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA
    9. Colobus angolensis palliatus miRNA
    10. Cricetulus griseus (Chinese hamster) microRNA 29b-2
    11. Dipodomys ordii miRNA
    12. Equus caballus (horse) microRNA eca-mir-29b precursor (eca-mir-29b-2)
    13. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-29b-2
    14. Gorilla gorilla microRNA ggo-mir-29b precursor (ggo-mir-29b-2)
    15. Ictidomys tridecemlineatus miRNA
    16. Loxodonta africana microRNA 29b-2
    17. Macaca fascicularis (Crab-eating macaque) miRNA
    18. Macaca mulatta microRNA mml-mir-29b precursor (mml-mir-29b-2)
    19. Macaca nemestrina microRNA mne-mir-29b precursor
    20. Mandrillus leucophaeus (Drill) miRNA
    21. Mesocricetus auratus (Golden Hamster) microRNA 29b-2 (Mir29b-2)
    22. Microcebus murinus miRNA
    23. Microtus ochrogaster microRNA 29b-2
    24. Mus caroli microRNA 29b-2
    25. Mus musculus (house mouse) microRNA mmu-mir-29b precursor (mmu-mir-29b-2)
    26. Mus pahari microRNA 29b-2
    27. Mus spretus microRNA 29b-2
    28. Myotis lucifugus miRNA
    29. Nannospalax galili miRNA
    30. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    31. Ochotona princeps miRNA
    32. Otolemur garnettii (small-eared galago) miRNA
    33. Ovis aries microRNA oar-mir-29b precursor (oar-mir-29b-1, oar-mir-29b-2)
    34. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-29b precursor (ppa-mir-29b-2)
    35. Panthera pardus miRNA
    36. Panthera tigris altaica (Tiger) microRNA 29b-2
    37. Pan troglodytes (chimpanzee) microRNA ptr-mir-29b precursor (ptr-mir-29b-2)
    38. Papio anubis (Olive baboon) miRNA
    39. Pongo abelii microRNA 29b-2
    40. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-29b precursor (ppy-mir-29b-2)
    41. Procavia capensis (cape rock hyrax) miRNA
    42. Propithecus coquereli (Coquerel's sifaka) miRNA
    43. Pteropus vampyrus miRNA
    44. Rattus norvegicus microRNA rno-mir-29b precursor (rno-mir-29b-2, rno-mir-29b-3)
    45. Rhinopithecus bieti miRNA
    46. Rhinopithecus roxellana miRNA
    47. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-29b precursor
    48. Saimiri boliviensis boliviensis miRNA
    49. Tursiops truncatus (bottlenosed dolphin) miRNA (MIR29B2)
    50. Vicugna pacos (alpaca) miRNA
    2D structure New