Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-29b precursor (hsa-mir-29b-2) URS00001E96DA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR29B2: MIR29B2 is a microRNA that has been implicated in various biological processes and diseases, including cancer. However, there is currently a lack of data on the specific role of MIR29B2 and its host gene MIR29B2CHG in cancer [PMC7859645]. In MDA-MB-231S cells, knockdown of LASP-1 resulted in the upregulation of two key microRNAs, miR29B1 and MIR29B2, which correlated with reduced levels of matrix metalloproteinase 9 (MMP9) [PMC4651668]. In humans, two genes on different chromosomes (MIR29B1 on chromosome 7 and MIR29B2 on chromosome 1) encode two precursors that give rise to mature miR-29b-1 and miR-29b-2 with identical sequences [PMC5643533]. Activation of MIR29B2 has been shown to inhibit the expression of the monocarboxylate transporter 1 (MCT1), leading to a disruption in insulin secretion [PMC7795239]. Differential expression of MIR29B2 has also been observed in late-relapse Hodgkin lymphoma samples compared to early-relapse samples [PMC7667426]. Furthermore, alterations in the expression levels of MIR29B2 have been associated with cancer-related genomic regions [PMC2683874]. Additionally, MIR29B2 has been identified as one of several differentially expressed genes (DEGs) in late-relapse Hodgkin lymphoma samples compared to early-relapse samples [PMC8345394]. Finally, elevated levels of miR-29b family members including MIR29B2 have been observed in a mouse brain endothelial cell line under conditions associated with elevated homocysteine levels [PMC6651274].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Aotus nancymaae miRNA (ENSANAG00000012107.1)
  2. Artibeus jamaicensis (Jamaican fruit-eating bat) microRNA aja-mir-29b precursor
  3. Bos taurus microRNA bta-mir-29b precursor (bta-mir-29b-2)
  4. Capra hircus chi-mir-29b (ENSCHIG00000001857.1)
  5. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000022228.2)
  6. Cebus imitator microRNA 29b-2 (ENSCCAG00000014462.1)
  7. Cercocebus atys miRNA (ENSCATG00000019703.1)
  8. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA (ENSCHOG00000014458.1)
  9. Colobus angolensis palliatus miRNA (ENSCANG00000004080.1)
  10. Cricetulus griseus miRNA (ENSCGRG00000021452.1, ENSCGRG00001008126.1)
  11. Dipodomys ordii (Ord's kangaroo rat) miRNA (ENSDORG00000021638.2)
  12. Equus caballus (horse) microRNA eca-mir-29b precursor (eca-mir-29b-2)
  13. Gorilla gorilla gorilla ggo-mir-29b-2 (ENSGGOG00000031229.2)
  14. Gorilla gorilla (western gorilla) microRNA ggo-mir-29b precursor (ggo-mir-29b-2)
  15. Ictidomys tridecemlineatus miRNA (ENSSTOG00000016717.1)
  16. Loxodonta africana (African savanna elephant) microRNA 29b-2 (ENSLAFG00000025291.1)
  17. Macaca mulatta microRNA mml-mir-29b precursor (mml-mir-29b-2)
  18. Macaca nemestrina microRNA mne-mir-29b precursor
  19. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000009487.1)
  20. Mesocricetus auratus (Golden Hamster) microRNA 29b-2 (ENSMAUG00000007122.1)
  21. Microcebus murinus (gray mouse lemur) microRNA 29b-2 (ENSMICG00000019155.3)
  22. Microtus ochrogaster microRNA 29b-2 (ENSMOCG00000010775.1)
  23. Mus caroli microRNA 29b-2 (MGP_CAROLIEiJ_G0007004.1)
  24. Mus musculus microRNA mmu-mir-29b precursor (mmu-mir-29b-2)
  25. Mus pahari microRNA 29b-2 (MGP_PahariEiJ_G0007532.1)
  26. Mus spretus microRNA 29b-2 (MGP_SPRETEiJ_G0007342.1)
  27. Myotis lucifugus (little brown bat) miRNA (ENSMLUG00000028668.1)
  28. Nannospalax galili (Upper Galilee mountains blind mole rat) microRNA 29b-2 (ENSNGAG00000002522.1)
  29. Nomascus leucogenys microRNA 29b-2 (ENSNLEG00000026040.2)
  30. Ochotona princeps miRNA (ENSOPRG00000018053.1, ENSOPRG00000018405.1)
  31. Otolemur garnettii miRNA (ENSOGAG00000017450.2)
  32. Ovis aries (sheep) microRNA oar-mir-29b precursor (oar-mir-29b-1, oar-mir-29b-2)
  33. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-29b precursor (ppa-mir-29b-2)
  34. Panthera pardus (leopard) miRNA (ENSPPRG00000013517.1, ENSPPRG00000013522.1, ENSPPRG00000013526.1)
  35. Panthera tigris altaica miRNA (ENSPTIG00000003456.1)
  36. Pan troglodytes (chimpanzee) microRNA ptr-mir-29b precursor (ptr-mir-29b-2)
  37. Pongo abelii (Sumatran orangutan) miRNA
  38. Pongo pygmaeus microRNA ppy-mir-29b precursor (ppy-mir-29b-2)
  39. Procavia capensis miRNA (ENSPCAG00000019197.1)
  40. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000001941.1)
  41. Pteropus vampyrus miRNA (ENSPVAG00000026935.1)
  42. Rattus norvegicus (Norway rat) microRNA rno-mir-29b precursor (rno-mir-29b-2, rno-mir-29b-3)
  43. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000019951.1)
  44. Rhinopithecus roxellana miRNA (ENSRROG00000025511.1)
  45. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-29b precursor
  46. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000016640.1)
  47. Tursiops truncatus (bottlenosed dolphin) microRNA 29b-2 (ENSTTRG00000022706.1, ENSTTRG00000023768.1)
  48. Vicugna pacos miRNA (ENSVPAG00000016729.1)
Publications