Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila persimilis (Fruit fly) miRNA FBtr0293714_df_nrg URS00001E7A02_7234

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCGAGGUAUAGAGUUCCUACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Drosophila erecta (Fruit fly) miRNA FBtr0291477_df_nrg
  2. Drosophila grimshawi dgr-miR-276a-5p
  3. Drosophila melanogaster dme-miR-276b-5p
  4. Drosophila mojavensis miRNA FBtr0293097_df_nrg
  5. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294511_df_nrg
  6. Drosophila sechellia (Fruit fly) miRNA FBtr0295197_df_nrg
  7. Drosophila simulans (Fruit fly) miRNA FBtr0296106_df_nrg
  8. Drosophila willistoni dwi-miR-276a-5p
  9. Drosophila yakuba miRNA FBtr0298759_df_nrg