Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila persimilis dpe-miR-287 URS00001E72A4_7234

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Drosophila persimilis. Annotated by 2 databases (Ensembl Metazoa, miRBase). Described in 1 paper. Drosophila persimilis dpe-miR-287 sequence is a product of FBtr0293769_df_nrg gene. Found in the Drosophila persimilis reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUGUUGAAAAUCGUUUGCAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Drosophila ananassae dan-miR-287
    2. Drosophila erecta der-miR-287
    3. Drosophila grimshawi dgr-miR-287
    4. Drosophila melanogaster dme-miR-287-3p
    5. Drosophila mojavensis dmo-miR-287
    6. Drosophila pseudoobscura dps-miR-287
    7. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294477_df_nrg
    8. Drosophila sechellia dse-miR-287
    9. Drosophila simulans dsi-miR-287
    10. Drosophila virilis dvi-miR-287
    11. Drosophila willistoni dwi-miR-287