Gorilla gorilla (western gorilla) ggo-miR-1306

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-1306 URS00001E5797_9593

21 nucleotides
1 database (miRBase)
Found in 7 other species
1 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

ACGUUGGCUCUGGUGGUGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Columba livia (rock pigeon) cli-miR-1306-3p
Cricetulus griseus (Chinese hamster) cgr-miR-1306-3p
Gorilla gorilla gorilla ggo-miR-1306 (MIR1306)
Mus musculus mmu-miR-1306-3p
Pteropus alecto pal-miR-1306-3p
Sus scrofa ssc-miR-1306-3p
Tupaia chinensis tch-miR-1306-3p

Publications