Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-127-3p URS00001E3DAA_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-127: In this work, rno-mir-127 blockade leads to KIF3B overexpression and endocytic activity increase [PMC3433485][PMC3433485]. Therefore, rno-mir-127 induction during I/R and H/R could protect cell-matrix and cell-cell adhesions trough KIF3B downregulation, among other mechanisms not yet identified, contributing to cell structure maintenance and epithelial barrier function [PMC3433485][PMC3433485]. rno-mir-127 overexpression by pre-miR transfection in NRK-52E cells promotes cell adhesion not only during normoxia but also after hypoxia (Figure 4A) [PMC3433485][PMC3433485]. In any case, our results indicate a great correlation between the expression of rno-mir-127 in both the in vitro and in vivo model in rat [PMC3433485][PMC3433485]. On the other hand, we identified here for the first time KIF3B as a real target of rno-mir-127 in rat proximal tubule cells during H/R [PMC3433485][PMC3433485]. Moreover, we have identified KIF3B, a component of kinesin II complex , as a real target of rno-mir-127 in proximal tubule cells, with potential implications in cell trafficking [PMC3433485][PMC3433485]. The rno-mir-127 was the most consistent and significantly modulated miRNA showing an increased expression during minimum medium hypoxia (mimicking ischemia) and 1 hour of reperfusion (Figure 1A) [PMC3433485][PMC3433485]. On the other hand, tight junctions (TJ) are essential for epithelial barrier impermeability, thus we investigated rno-mir-127 modulation effects in these structures [PMC3433485][PMC3433485]. Regarding a potential protective role of miR-127 in response to I/R, this work describes for the first time the effects of rno-mir-127 modulation in actin cytoskeleton organization and adhesive structures integrity during I/R injury [PMC3433485][PMC3433485]. All these data demonstrate that rno-mir-127 induction promotes cell adhesion and cytoskeleton structure maintenance during H/R [PMC3433485][PMC3433485]. These results demonstrate that KIF3B is a target gene for rno-mir-127 in NRK-52E cells during H/R, both regulating proximal tubule cell function [PMC3433485][PMC3433485]. rno-mir-127 is increased during hypoxia and Ischemia and at 1h and 24 hours of reperfusion respectively, time points where cellular damage or renal tissue damage is maximum in this model [PMC3433485][PMC3433485]. To go further into the biological significance of rno-mir-127 induction, we performed a bioinformatics target prediction for this miRNA using different databases available online, such as microcosm (www.pictar.mdc-berlin.de) [PMC3433485][PMC3433485]. In this work, we have identified rno-mir-127 and its human homologous hsa-miR-127-3p as important mediators of the proximal tubule response to I/R [PMC3433485][PMC3433485]. Moreover, rno-mir-127 is also induced during ischemia and 24 hours of reperfusion in our in vivo rat model of I/R (Figure 1B) [PMC3433485][PMC3433485]. rno-mir-127 induction during I/R is a cytoskeleton protection mechanism which prevents actin depolimerization and promotes cell adhesion by preventing FAC disassembly and TJ disorganization [PMC3433485][PMC3433485]. Furthermore, rno-mir-127 blockade by anti-miR aggravates cytoskeleton and adhesion structures disorganization caused by hypoxia [PMC3433485][PMC3433485]. Following renal ischemia and reperfusion in rats, an increased expression of rno-mir-127 was found, and Kinesin Family Member 3B (KIF3B), which is involved in cellular endocytosis, was identified as a novel target of miR-127 [PMC4442302][PMC4442302].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGAUCCGUCUGAGCUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Ateles geoffroyi age-miR-127
  2. Bos taurus (cattle) bta-miR-127
  3. Canis lupus familiaris cfa-miR-127
  4. Cavia porcellus cpo-miR-127-3p
  5. Cervus elaphus (red deer) cel-miR-127
  6. Cricetulus griseus (Chinese hamster) cgr-miR-127
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-127-3p
  8. Daubentonia madagascariensis (aye-aye) dma-miR-127
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-127_3p (mature (guide))
  10. Equus caballus (horse) eca-miR-127
  11. Homo sapiens (human) hsa-miR-127-3p
  12. Lagothrix lagotricha (brown woolly monkey) lla-miR-127
  13. Macaca mulatta (Rhesus monkey) mml-miR-127-3p
  14. Macaca nemestrina mne-miR-127
  15. Mus musculus mmu-miR-127-3p
  16. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-127
  17. Oryctolagus cuniculus (rabbit) ocu-miR-127-3p
  18. Otolemur garnettii (small-eared galago) oga-miR-127
  19. Pan paniscus (pygmy chimpanzee) ppa-miR-127
  20. Pan troglodytes ptr-miR-127
  21. Papio hamadryas pha-miR-127
  22. Pongo pygmaeus ppy-miR-127
  23. Pteropus alecto pal-miR-127-3p
  24. Saguinus labiatus sla-miR-127
  25. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-127
  26. Sus scrofa ssc-miR-127
  27. Tupaia chinensis tch-miR-127-3p
Publications