Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis elegans microRNA cel-mir-237 precursor URS00001E3955_6239

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cel-mir-237: Cel-mir-237 is a microRNA (miRNA) that has been identified as a potential predictor of radioresistance [PMC4247386]. It has been found that loss of cel-mir-237 is associated with radioresistance [PMC5173455]. Additionally, there is a temporal correlation between cel-mir-237 and jun-1 expression post-γ-irradiation [PMC5173455]. Experimental studies have shown that cel-mir-237 can alter radiation sensitivity and downregulate jun-1 levels, which is important for cellular survival post-γ-irradiation [PMC5173455]. The expression profile of cel-mir-237 is inversely correlated with jun-1 expression [PMC5173455]. Both cel-mir-237 and hsa-miR125b have been found to induce radiation sensitivity by targeting and downregulating JUN [PMC5173455]. It has been predicted that jun1 is a target of cel-mir-237 based on sequence and conservation analysis [PMC5173455]. The loss of cel-mir-237 protects cells from γ-radiation, while overexpression of cel-miR 237 promotes radiosensitivity in C. elegans nematodes [PMC5173455]. The levels of cel-miR 237 significantly decrease in wild-type N2 animals after γ-radiation treatment, suggesting an active downregulation mechanism to promote survival during and after γ-radiation exposure [PMC5173455].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCUACAUUGCGUGGUCCCUGAGAAUUCUCGAACAGCUUCAAAGUGUUCAAGCUGUCGAGUUUUGUCAAGGACCAAACAAUAGAAGAUCACUUGGGAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications