Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-137 URS00001E3523_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUUGCUUAAGAAUACGCGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis Ami-Mir-137-P1-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-137a
  3. Bos taurus (cattle) bta-miR-137
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-137
  5. Callorhinchus milii (elephant shark) Cmi-Mir-137-P1_3p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-137-P1-v1_3p (mature (guide))
  7. Chrysemys picta bellii Cpi-Mir-137-P1-v1_3p (mature (guide))
  8. Chrysemys picta cpi-miR-137a-3p
  9. Columba livia (rock pigeon) cli-miR-137a-3p
  10. Cricetulus griseus (Chinese hamster) cgr-miR-137-3p
  11. Cyprinus carpio (common carp) ccr-miR-137
  12. Danio rerio Dre-Mir-137-P1b-v1_3p (mature (guide))
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-137-3p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-137-P1-v1_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-137
  16. Gadus morhua (Atlantic cod) Gmo-Mir-137-P1b-v1_3p (mature (guide))
  17. Gallus gallus Gga-Mir-137-P1-v1_3p (mature (guide))
  18. Gekko japonicus Gja-Mir-137-P1-v1_3p (mature (guide))
  19. Homo sapiens (human) hsa-miR-137-3p
  20. Ictalurus punctatus ipu-miR-137
  21. Latimeria chalumnae (coelacanth) Lch-Mir-137-P1_3p (mature (guide))
  22. Lepisosteus oculatus Loc-Mir-137-P1-v1_3p (mature (guide))
  23. Macaca mulatta (Rhesus monkey) mml-miR-137-3p
  24. Microcaecilia unicolor Mun-Mir-137-P1_3p (mature (guide))
  25. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-137-P1-v1_3p (mature (guide))
  26. Monopterus albus Mal-Mir-137-P1b-v1_3p (mature (guide))
  27. Mus musculus mmu-miR-137-3p
  28. Oreochromis niloticus oni-miR-137a
  29. Ornithorhynchus anatinus (platypus) oan-miR-137a-3p
  30. Oryctolagus cuniculus (rabbit) Ocu-Mir-137-P1-v1_3p (mature (guide))
  31. Pongo pygmaeus ppy-miR-137
  32. Python bivittatus pbv-miR-137a-3p
  33. Rattus norvegicus rno-miR-137-3p
  34. Sarcophilus harrisii Sha-Mir-137-P1-v1_3p (mature (guide))
  35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-137-P1_3p (mature (guide))
  36. Sphenodon punctatus Spt-Mir-137-P1_3p (mature (guide))
  37. Sus scrofa ssc-miR-137
  38. Taeniopygia guttata tgu-miR-137-3p
  39. Xenopus laevis Xla-Mir-137-P1_3p (mature (guide))
  40. Xenopus tropicalis Xtr-Mir-137-P1_3p (mature (guide))
Publications