v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-137-3p URS00001E3523_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-137: Rno-mir-137 is a microRNA that has been studied in the context of propofol treatment in primary cultured embryonic NSCs [PMC4171549]. The primer sequences for the amplification of rno-mir-137 were 5′-TT + ATT + GCTTAAGAATA-3′ (forward) and 5′-GTAAAACGACGGCCAGTCTACGCG-3′ (forward) [PMC4171549]. Propofol was found to regulate the expression of rno-mir-137 and its target genes, ARC and EGR2 [PMC5064799]. The expression levels of rno-mir-137 were downregulated at T1 but upregulated from T2 to T4 [PMC5064799]. Additionally, rno-miR-19a, rno-miR-19b-2, and rno-miR-214 were downregulated at all four time-points [PMC5064799]. The fold-change in the mean expression levels of rno-mir-137 ranged from -2.02 to 4.61 [PMC5064799]. These findings suggest that propofol treatment can modulate the expression of rno-mir-137 and other miRNAs in primary cultured embryonic NSCs [PMC5064799].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUAUUGCUUAAGAAUACGCGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis Ami-Mir-137-P1-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-137a
  3. Bos taurus (cattle) bta-miR-137
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-137
  5. Callorhinchus milii (elephant shark) Cmi-Mir-137-P1_3p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-137-P1-v1_3p (mature (guide))
  7. Chrysemys picta bellii Cpi-Mir-137-P1-v1_3p (mature (guide))
  8. Chrysemys picta cpi-miR-137a-3p
  9. Columba livia (rock pigeon) cli-miR-137a-3p
  10. Cricetulus griseus (Chinese hamster) cgr-miR-137-3p
  11. Cyprinus carpio (common carp) ccr-miR-137
  12. Danio rerio Dre-Mir-137-P1b-v1_3p (mature (guide))
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-137-3p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-137-P1-v1_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-137
  16. Gadus morhua (Atlantic cod) Gmo-Mir-137-P1b-v1_3p (mature (guide))
  17. Gallus gallus Gga-Mir-137-P1-v1_3p (mature (guide))
  18. Gekko japonicus Gja-Mir-137-P1-v1_3p (mature (guide))
  19. Homo sapiens (human) hsa-miR-137-3p
  20. Ictalurus punctatus ipu-miR-137
  21. Latimeria chalumnae (coelacanth) Lch-Mir-137-P1_3p (mature (guide))
  22. Lepisosteus oculatus Loc-Mir-137-P1-v1_3p (mature (guide))
  23. Macaca mulatta (Rhesus monkey) mml-miR-137-3p
  24. Microcaecilia unicolor Mun-Mir-137-P1_3p (mature (guide))
  25. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-137-P1-v1_3p (mature (guide))
  26. Monopterus albus Mal-Mir-137-P1b-v1_3p (mature (guide))
  27. Mus musculus mmu-miR-137-3p
  28. Oreochromis niloticus oni-miR-137a
  29. Ornithorhynchus anatinus (platypus) oan-miR-137a-3p
  30. Oryctolagus cuniculus (rabbit) Ocu-Mir-137-P1-v1_3p (mature (guide))
  31. Pan troglodytes ptr-miR-137
  32. Pongo pygmaeus ppy-miR-137
  33. Python bivittatus pbv-miR-137a-3p
  34. Sarcophilus harrisii Sha-Mir-137-P1-v1_3p (mature (guide))
  35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-137-P1_3p (mature (guide))
  36. Sphenodon punctatus Spt-Mir-137-P1_3p (mature (guide))
  37. Sus scrofa ssc-miR-137
  38. Taeniopygia guttata tgu-miR-137-3p
  39. Xenopus laevis Xla-Mir-137-P1_3p (mature (guide))
  40. Xenopus tropicalis Xtr-Mir-137-P1_3p (mature (guide))
 Publications