Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-137-3p URS00001E3523_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (miRBase, MirGeneDB, PSICQUIC, LncBase, TarBase, RefSeq, ENA, GeneCards, MalaCards). Described in 74 papers. Homo sapiens (human) hsa-miR-137-3p sequence is a product of hsa-miR-137, hsa-miR-137-3p, miR-137, MIR137, miR-137-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 2C4D, 2H9, 3D3, 53BP1, 5PTASE, 8B, 9G8, A-FABP, A121, AAAT.

Interactions 18

According to PSICQUIC, Homo sapiens (human) hsa-miR-137-3p interacts with:

Interaction id Participant Synonyms
URS00001E3523_9606-0 O14786 O14786
URS00001E3523_9606-9 O14786 O14786
URS00001E3523_9606-10 O60341 O60341
URS00001E3523_9606-1 O60341 O60341
URS00001E3523_9606-2 P21246 P21246
URS00001E3523_9606-11 P21246 P21246
URS00001E3523_9606-3 P24593 P24593
URS00001E3523_9606-12 P24593 P24593
URS00001E3523_9606-4 Q13562 Q13562
URS00001E3523_9606-13 Q13562 Q13562
URS00001E3523_9606-5 Q13936 Q13936
URS00001E3523_9606-14 Q13936 Q13936
URS00001E3523_9606-15 Q15375 Q15375
URS00001E3523_9606-6 Q15375 Q15375
URS00001E3523_9606-16 Q8NFP9 Q8NFP9
URS00001E3523_9606-7 Q8NFP9 Q8NFP9
URS00001E3523_9606-8 Q9H1E3 Q9H1E3
URS00001E3523_9606-17 Q9H1E3 Q9H1E3

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUAUUGCUUAAGAAUACGCGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 59 other species

    1. Alligator mississippiensis Ami-Mir-137-P1-v1_3p (mature (guide))
    2. Anolis carolinensis aca-miR-137a
    3. Bos taurus (cattle) bta-miR-137
    4. Callithrix jacchus cja-miR-137
    5. Callorhinchus milii (elephant shark) eshark_mir-137_1
    6. Canis lupus familiaris Cfa-Mir-137-P1-v1_3p (mature (guide))
    7. Chrysemys picta bellii Cpi-Mir-137-P1-v1_3p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-137a-3p
    9. Columba livia (rock pigeon) cli-miR-137a-3p
    10. Cricetulus griseus cgr-miR-137-3p
    11. Cyprinus carpio ccr-miR-137
    12. Danio rerio (zebrafish) Dre-Mir-137-P1b-v1_3p (mature (guide))
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-137-3p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-137-P1-v1_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-137
    16. Gallus gallus (chicken) Gga-Mir-137-P1-v1_3p (mature (guide))
    17. Ictalurus punctatus (channel catfish) ipu-miR-137
    18. Macaca mulatta mml-miR-137-3p
    19. Monodelphis domestica Mdo-Mir-137-P1-v1_3p (mature (guide))
    20. Mus musculus (house mouse) mmu-miR-137-3p
    21. Oreochromis niloticus oni-miR-137a
    22. Ornithorhynchus anatinus oan-miR-137a-3p
    23. Oryctolagus cuniculus (rabbit) Ocu-Mir-137-P1-v1_3p (mature (guide))
    24. Pan troglodytes (chimpanzee) ptr-miR-137
    25. Pongo pygmaeus ppy-miR-137
    26. Python bivittatus pbv-miR-137a-3p
    27. Rattus norvegicus rno-miR-137-3p
    28. Sarcophilus harrisii Sha-Mir-137-P1-v1_3p (mature (guide))
    29. Scyliorhinus torazame (cloudy catshark) Sto-Mir-137-P1_3p (mature (guide))
    30. Sus scrofa ssc-miR-137
    31. Taeniopygia guttata (zebra finch) tgu-miR-137-3p
    32. Xenopus tropicalis Xtr-Mir-137-P1d_3p (mature (guide))