Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-137-3p URS00001E3523_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-137: Interestingly, among the ncRNA-induced genes following Sin1 is MIR137HG (Table 1), a precursor of hsa-mir-137 and hsa-miR-2682, two highly expressed miRNAs of the CNS and especially the brain cortex [PMC9680243]. Because CKS1B copy gain and increased expression in hypoxia were KDM4A-dependent, we hypothesized that hsa-mir-23a/b and hsa-mir-137 would promote gain and increased expression for CKS1B [PMC4777823]. We then found downregulation of hsa-mir-137 after PMs exposure in RA-FLS, suggesting its role in the PMs-induced RA exacerbation [PMC7348867].

mRNA interactions 11 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUUGCUUAAGAAUACGCGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis Ami-Mir-137-P1-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-137a
  3. Bos taurus (cattle) bta-miR-137
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-137
  5. Callorhinchus milii (elephant shark) Cmi-Mir-137-P1_3p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-137-P1-v1_3p (mature (guide))
  7. Chrysemys picta bellii Cpi-Mir-137-P1-v1_3p (mature (guide))
  8. Chrysemys picta cpi-miR-137a-3p
  9. Columba livia (rock pigeon) cli-miR-137a-3p
  10. Cricetulus griseus (Chinese hamster) cgr-miR-137-3p
  11. Cyprinus carpio (common carp) ccr-miR-137
  12. Danio rerio Dre-Mir-137-P1b-v1_3p (mature (guide))
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-137-3p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-137-P1-v1_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-137
  16. Gadus morhua (Atlantic cod) Gmo-Mir-137-P1b-v1_3p (mature (guide))
  17. Gallus gallus Gga-Mir-137-P1-v1_3p (mature (guide))
  18. Gekko japonicus Gja-Mir-137-P1-v1_3p (mature (guide))
  19. Ictalurus punctatus ipu-miR-137
  20. Latimeria chalumnae (coelacanth) Lch-Mir-137-P1_3p (mature (guide))
  21. Lepisosteus oculatus Loc-Mir-137-P1-v1_3p (mature (guide))
  22. Macaca mulatta (Rhesus monkey) mml-miR-137-3p
  23. Microcaecilia unicolor Mun-Mir-137-P1_3p (mature (guide))
  24. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-137-P1-v1_3p (mature (guide))
  25. Monopterus albus Mal-Mir-137-P1b-v1_3p (mature (guide))
  26. Mus musculus mmu-miR-137-3p
  27. Oreochromis niloticus oni-miR-137a
  28. Ornithorhynchus anatinus (platypus) oan-miR-137a-3p
  29. Oryctolagus cuniculus (rabbit) Ocu-Mir-137-P1-v1_3p (mature (guide))
  30. Pan troglodytes ptr-miR-137
  31. Pongo pygmaeus ppy-miR-137
  32. Python bivittatus pbv-miR-137a-3p
  33. Rattus norvegicus rno-miR-137-3p
  34. Sarcophilus harrisii Sha-Mir-137-P1-v1_3p (mature (guide))
  35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-137-P1_3p (mature (guide))
  36. Sphenodon punctatus Spt-Mir-137-P1_3p (mature (guide))
  37. Sus scrofa ssc-miR-137
  38. Taeniopygia guttata tgu-miR-137-3p
  39. Xenopus laevis Xla-Mir-137-P1_3p (mature (guide))
  40. Xenopus tropicalis Xtr-Mir-137-P1_3p (mature (guide))
Publications