Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-142-5p URS00001E0AEA_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (LncBase, RefSeq, MalaCards, MirGeneDB, PSICQUIC, TarBase, IntAct, GeneCards, ENA, miRBase). Described in 69 papers. Homo sapiens (human) hsa-miR-142-5p sequence is a product of hsa-miR-142, hsa-miR-142-5p, miR-142, MIR142, miR-142-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1R20, 3'HEXO, 3-PAP, 3D3, 3PAP, A20, A214N16.3, A6, AAK1, ABHD10.

Interactions 3

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-142-5p interacts with:

Interaction id Participant Synonyms
EBI-25682797 intact:EBI-25682775 EBI-25682775 ENST00000337514 mrna_igf1
URS00001E0AEA_9606-0 O95832 O95832
URS00001E0AEA_9606-1 O95832 O95832

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAUAAAGUAGAAAGCACUACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 63 other species

    1. Alligator mississippiensis Ami-Mir-142-P3-v1_5p (mature (guide))
    2. Anolis carolinensis Aca-Mir-142-P4-v1_5p (mature (guide))
    3. Bos taurus (cattle) Bta-Mir-142-v1_5p (mature (guide))
    4. Canis lupus familiaris Cfa-Mir-142-v1_5p (mature (guide))
    5. Cavia porcellus (domestic guinea pig) cpo-miR-142-5p
    6. Chrysemys picta bellii Cpi-Mir-142-P3-v1_5p (mature (guide))
    7. Columba livia (rock pigeon) cli-miR-142-5p
    8. Danio rerio (zebrafish) dre-miR-142a-5p
    9. Dasypus novemcinctus (nine-banded armadillo) dno-miR-142-5p
    10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-142-v1_5p (mature (guide))
    11. Equus caballus (horse) eca-miR-142-5p
    12. Gadus morhua gmo-miR-142-5p
    13. Gallus gallus (chicken) Gga-Mir-142-P3-v1_5p (mature (guide))
    14. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-142-5p
    15. Macaca mulatta mml-miR-142-5p
    16. Maylandia zebra mze-miR-142
    17. Monodelphis domestica Mdo-Mir-142-v1_5p (mature (guide))
    18. Mus musculus (house mouse) mmu-miR-142a-5p
    19. Neolamprologus brichardi nbr-miR-142
    20. Oreochromis niloticus oni-miR-142
    21. Ornithorhynchus anatinus oan-miR-142-5p
    22. Oryctolagus cuniculus (rabbit) ocu-miR-142-5p
    23. Pongo pygmaeus ppy-miR-142-5p
    24. Pundamilia nyererei pny-miR-142
    25. Rattus norvegicus rno-miR-142-5p
    26. Salmo salar (Atlantic salmon) ssa-miR-142a-5p
    27. Sarcophilus harrisii Sha-Mir-142-v1_5p (mature (guide))
    28. Scyliorhinus torazame (cloudy catshark) Sto-Mir-142-v1_5p (mature (guide))
    29. Sus scrofa ssc-miR-142-5p
    30. Taeniopygia guttata (zebra finch) Tgu-Mir-142-P3-v1_5p (mature (guide))
    31. Takifugu rubripes (torafugu) fru-miR-142
    32. Tetraodon nigroviridis tni-miR-142a
    33. Tor tambroides miR-142a-5p
    34. Xenopus tropicalis Xtr-Mir-142-P6-v1_5p (mature (guide))