Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30e-5p URS00001DE669_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-30e: Hsa-mir-30e, along with HSA-miR-647 and HSA-let-7E, has been identified as a potential marker for nasopharyngeal carcinoma (NPC) [PMC8742958]. Additionally, a study on the effects of exhaustive exercise found that hsa-mir-30e was one of six miRNAs that showed altered expression in controls [PMC4092108]. These findings suggest that hsa-mir-30e may have diagnostic and prognostic value in NPC and could also be influenced by physical activity. Hsa-mir-30e is a type of microRNA (miRNA) that has not been previously associated with NPC [PMC8742958]. MiRNAs are small non-coding RNA molecules that play important roles in gene regulation by targeting messenger RNA (mRNA) for degradation or translational repression [PMC4092108]. The dysregulation of miRNAs has been implicated in various diseases, including cancer. In the context of NPC, hsa-mir-30e, along with HSA-miR-647 and HSA-let-7E, has shown potential as new markers for the disease [PMC8742958]. These miRNAs may have diagnostic value in identifying NPC and could potentially be used as non-invasive biomarkers for early detection or monitoring disease progression. Furthermore, the altered expression of hsa-mir-30e due to exhaustive exercise suggests a potential link between physical activity and miRNA regulation [PMC4092108]. This finding highlights the importance of considering lifestyle factors when studying miRNA expression patterns. In conclusion, hsa-mir-30e is a type of miRNA that shows promise as a marker for NPC and may be influenced by physical activity. Further research is needed to fully understand its role in disease progression and its potential as a diagnostic or prognostic tool.

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUUGACUGGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Danio rerio (zebrafish) dre-miR-30e-5p
  2. Equus caballus eca-miR-30e
  3. Macaca fascicularis (crab-eating macaque) microRNA miR-30e-5p
  4. Macaca mulatta (Rhesus monkey) mml-miR-30e-5p
  5. Mus musculus mmu-miR-30e-5p
  6. Pan troglodytes ptr-miR-30e
  7. Pongo pygmaeus ppy-miR-30e
  8. Rattus norvegicus rno-miR-30e-5p
  9. Xenopus tropicalis (tropical clawed frog) xtr-miR-30e
Publications