Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-1 URS00001DC04F_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-miR-1: dre-mir-1 is a microRNA that specifically targets a single mRNA [PMC8301059]. The expression of dre-mir-1 was detected in both muscle and heart, where it plays an important regulatory role [PMC2684549]. In zebrafish embryos, dre-mir-1 was found to be expressed at 4 days post fertilization (dpf) [PMC6854364]. The top 5 most abundant miRNA families expressed at each stage included dre-mir-1 [PMC3932949]. In HEK293T cells, dre-mir-1 mimics or negative control and wild-type or mutated reporter vector were transfected to study its function [PMC6854364]. Additionally, zebrafish experiments involving dre-mir-1 knockdown in GFP muscle and CNS cells were conducted [GSE12991], as well as knockdown of dre-miR-430 in embryo cells [GSE4201] to investigate its role in development. Overall, dre-mir-1 is a microRNA that targets a single mRNA and is expressed in both muscle and heart. It plays important regulatory roles in zebrafish development and has been studied using knockdown experiments and transfection assays.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAAGAAGUAUGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 64 other species

  1. Alligator mississippiensis ami-miR-1a-3p
  2. Anolis carolinensis (green anole) aca-miR-1a-3p
  3. Bos taurus (cattle) bta-miR-1
  4. Branchiostoma belcheri bbe-miR-1-5p
  5. Branchiostoma floridae (Florida lancelet) bfl-miR-1-3p
  6. Branchiostoma lanceolatum Bla-Mir-1_3p (mature (guide))
  7. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1a
  8. Callorhinchus milii Cmi-Mir-1-P4_3p (mature (guide))
  9. Canis lupus familiaris Cfa-Mir-1-P1_3p (mature (guide))
  10. Capra hircus (goat) chi-miR-1
  11. Cavia porcellus (domestic guinea pig) cpo-miR-1a-3p
  12. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P1_3p (mature (guide))
  13. Chrysemys picta cpi-miR-1a-3p
  14. Columba livia cli-miR-1a-3p
  15. Crassostrea gigas (Pacific oyster) Cgi-Mir-1_3p (mature (guide))
  16. Cyprinus carpio ccr-miR-1
  17. Dasypus novemcinctus dno-miR-1-3p
  18. Echinops telfairi Ete-Mir-1-P1_3p (mature (guide))
  19. Eptatretus burgeri Ebu-Mir-1-P7_3p (mature (guide))
  20. Eptesicus fuscus (big brown bat) efu-miR-1
  21. Equus caballus (horse) eca-miR-1
  22. Gadus morhua (Atlantic cod) gmo-miR-1-3p
  23. Gallus gallus Gga-Mir-1-P1_3p (mature (guide))
  24. Gekko japonicus Gja-Mir-1-P1_3p (mature (guide))
  25. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-1
  26. Hippoglossus hippoglossus hhi-miR-1
  27. Homo sapiens (human) hsa-miR-1-3p
  28. Latimeria chalumnae Lch-Mir-1-P1_3p (mature (guide))
  29. Lepisosteus oculatus (spotted gar) Loc-Mir-1-P1_3p (mature (guide))
  30. Lottia gigantea (owl limpet) lgi-miR-1
  31. Lytechinus variegatus (green sea urchin) lva-miR-1-3p
  32. Macaca mulatta mml-miR-1-3p
  33. Maylandia zebra (zebra mbuna) mze-miR-1
  34. Melibe leonina mle-miR-1-3p
  35. Microcaecilia unicolor Mun-Mir-1-P1_3p (mature (guide))
  36. Monodelphis domestica (gray short-tailed opossum) mdo-miR-1-3p
  37. Monopterus albus (swamp eel) Mal-Mir-1-P1_3p (mature (guide))
  38. Mus musculus mmu-miR-1a-3p
  39. Nautilus pompilius Npo-Mir-1-P20_3p (mature (guide))
  40. Neolamprologus brichardi (lyretail cichlid) nbr-miR-1
  41. Ophiophagus hannah (king cobra) oha-miR-1b-3p
  42. Oreochromis niloticus (Nile tilapia) oni-miR-1
  43. Ornithorhynchus anatinus oan-miR-1a-3p
  44. Oryctolagus cuniculus (rabbit) ocu-miR-1-3p
  45. Pan troglodytes ptr-miR-1
  46. Paralichthys olivaceus (Japanese flounder) pol-miR-1-3p
  47. Patiria miniata (sea bat) pmi-miR-1-3p
  48. Petromyzon marinus (sea lamprey) Pma-Mir-1-o3_3p (mature (guide))
  49. Pongo pygmaeus ppy-miR-1
  50. Pteropus alecto (black flying fox) pal-miR-1-3p
  51. Pundamilia nyererei pny-miR-1
  52. Python bivittatus Pbv-Mir-1-P3_3p (mature (guide))
  53. Rattus norvegicus rno-miR-1b
  54. Salmo salar (Atlantic salmon) ssa-miR-1-3p
  55. Sarcophilus harrisii Sha-Mir-1-P1_3p (mature (guide))
  56. Scyliorhinus torazame Sto-Mir-1-P1_3p (mature (guide))
  57. Sphenodon punctatus Spt-Mir-1-P1_3p (mature (guide))
  58. Strongylocentrotus purpuratus spu-miR-1
  59. Taeniopygia guttata (zebra finch) tgu-miR-1-3p
  60. Takifugu rubripes fru-miR-1
  61. Tetraodon nigroviridis tni-miR-1
  62. Tor tambroides miR-1
  63. Xenopus laevis (African clawed frog) xla-miR-1a-3p
  64. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-1-P1_3p (mature (guide))
Publications