Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-1 URS00001DC04F_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (ENA, MirGeneDB, RefSeq, miRBase). Danio rerio (zebrafish) dre-miR-1 sequence is a product of mir1-2, dre-miR-1, miR-1, mir1-1 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGAAUGUAAAGAAGUAUGUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 64 other species

    1. Alligator mississippiensis (American alligator) ami-miR-1a-3p
    2. Anolis carolinensis aca-miR-1a-3p
    3. Bos taurus (cattle) bta-miR-1
    4. Branchiostoma belcheri bbe-miR-1-5p
    5. Branchiostoma floridae bfl-miR-1-3p
    6. Branchiostoma lanceolatum (amphioxus) Bla-Mir-1_3p (mature (guide))
    7. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1a
    8. Callorhinchus milii (elephant shark) Cmi-Mir-1-P4_3p (mature (guide))
    9. Canis lupus familiaris Cfa-Mir-1-P1_3p (mature (guide))
    10. Capra hircus chi-miR-1
    11. Cavia porcellus (domestic guinea pig) cpo-miR-1a-3p
    12. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P1_3p (mature (guide))
    13. Chrysemys picta (Painted turtle) cpi-miR-1a-3p
    14. Columba livia cli-miR-1a-3p
    15. Crassostrea gigas (Pacific oyster) Cgi-Mir-1_3p (mature (guide))
    16. Cyprinus carpio (common carp) ccr-miR-1
    17. Dasypus novemcinctus dno-miR-1-3p
    18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1-P1_3p (mature (guide))
    19. Eptatretus burgeri Ebu-Mir-1-P7_3p (mature (guide))
    20. Eptesicus fuscus (big brown bat) efu-miR-1
    21. Equus caballus (horse) eca-miR-1
    22. Gadus morhua (Atlantic cod) gmo-miR-1-3p
    23. Gallus gallus Gga-Mir-1-P1_3p (mature (guide))
    24. Gekko japonicus Gja-Mir-1-P1_3p (mature (guide))
    25. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-1
    26. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-1
    27. Homo sapiens (human) hsa-miR-1-3p
    28. Latimeria chalumnae Lch-Mir-1-P1_3p (mature (guide))
    29. Lepisosteus oculatus Loc-Mir-1-P1_3p (mature (guide))
    30. Lottia gigantea (owl limpet) lgi-miR-1
    31. Lytechinus variegatus lva-miR-1-3p
    32. Macaca mulatta mml-miR-1-3p
    33. Maylandia zebra (zebra mbuna) mze-miR-1
    34. Melibe leonina mle-miR-1-3p
    35. Microcaecilia unicolor Mun-Mir-1-P1_3p (mature (guide))
    36. Monodelphis domestica (gray short-tailed opossum) mdo-miR-1-3p
    37. Monopterus albus (swamp eel) Mal-Mir-1-P1_3p (mature (guide))
    38. Mus musculus (house mouse) mmu-miR-1a-3p
    39. Nautilus pompilius Npo-Mir-1-P20_3p (mature (guide))
    40. Neolamprologus brichardi nbr-miR-1
    41. Ophiophagus hannah (king cobra) oha-miR-1b-3p
    42. Oreochromis niloticus oni-miR-1
    43. Ornithorhynchus anatinus oan-miR-1a-3p
    44. Oryctolagus cuniculus (rabbit) ocu-miR-1-3p
    45. Pan troglodytes (chimpanzee) ptr-miR-1
    46. Paralichthys olivaceus pol-miR-1-3p
    47. Patiria miniata pmi-miR-1-3p
    48. Petromyzon marinus Pma-Mir-1-o3_3p (mature (guide))
    49. Pongo pygmaeus ppy-miR-1
    50. Pteropus alecto pal-miR-1-3p
    51. Pundamilia nyererei pny-miR-1
    52. Python bivittatus Pbv-Mir-1-P3_3p (mature (guide))
    53. Rattus norvegicus (Norway rat) rno-miR-1b
    54. Salmo salar (Atlantic salmon) ssa-miR-1-3p
    55. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-1-P1_3p (mature (guide))
    56. Scyliorhinus torazame Sto-Mir-1-P1_3p (mature (guide))
    57. Sphenodon punctatus Spt-Mir-1-P1_3p (mature (guide))
    58. Strongylocentrotus purpuratus spu-miR-1
    59. Taeniopygia guttata tgu-miR-1-3p
    60. Takifugu rubripes (torafugu) fru-miR-1
    61. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-1
    62. Tor tambroides (Thai mahseer) miR-1
    63. Xenopus laevis (African clawed frog) xla-miR-1a-3p
    64. Xenopus tropicalis Xtr-Mir-1-P1_3p (mature (guide))
    Publications New