Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-1 URS00001DC04F_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (RefSeq, MirGeneDB, miRBase, ENA). Described in 28 papers. Danio rerio (zebrafish) dre-miR-1 sequence is a product of mir1-2, miR-1, mir1-1, dre-miR-1 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAAUGUAAAGAAGUAUGUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 52 other species

    1. Alligator mississippiensis (American alligator) ami-miR-1a-3p
    2. Anolis carolinensis aca-miR-1a-3p
    3. Bos taurus bta-miR-1
    4. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-1-5p
    5. Branchiostoma floridae (Florida lancelet) bfl-miR-1-3p
    6. Callithrix jacchus cja-miR-1a
    7. Callorhinchus milii (elephant shark) eshark_mir-1_2
    8. Canis lupus familiaris (dog) Cfa-Mir-1-P2_3p (mature (guide))
    9. Capra hircus (goat) chi-miR-1
    10. Cavia porcellus cpo-miR-1a-3p
    11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P2_3p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-miR-1a-3p
    13. Columba livia (rock pigeon) cli-miR-1a-3p
    14. Crassostrea gigas (Pacific oyster) Cgi-Mir-1_3p (mature (guide))
    15. Cyprinus carpio ccr-miR-1
    16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-1-3p
    17. Echinops telfairi Ete-Mir-1-P2_3p (mature (guide))
    18. Eptesicus fuscus efu-miR-1
    19. Equus caballus eca-miR-1
    20. Gadus morhua (Atlantic cod) gmo-miR-1-3p
    21. Gallus gallus (chicken) Gga-Mir-1-P2_3p (mature (guide))
    22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-1
    23. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-1
    24. Homo sapiens hsa-miR-1-3p
    25. Lottia gigantea (owl limpet) lgi-miR-1
    26. Lytechinus variegatus lva-miR-1-3p
    27. Macaca mulatta (Rhesus monkey) mml-miR-1-3p
    28. Maylandia zebra mze-miR-1
    29. Melibe leonina mle-miR-1-3p
    30. Monodelphis domestica mdo-miR-1-3p
    31. Mus musculus (house mouse) mmu-miR-1a-3p
    32. Neolamprologus brichardi nbr-miR-1
    33. Ophiophagus hannah (king cobra) oha-miR-1b-3p
    34. Oreochromis niloticus oni-miR-1
    35. Ornithorhynchus anatinus (platypus) oan-miR-1a-3p
    36. Oryctolagus cuniculus (rabbit) ocu-miR-1-3p
    37. Pan troglodytes (chimpanzee) ptr-miR-1
    38. Paralichthys olivaceus pol-miR-1-3p
    39. Patiria miniata pmi-miR-1-3p
    40. Pongo pygmaeus ppy-miR-1
    41. Pteropus alecto (black flying fox) pal-miR-1-3p
    42. Pundamilia nyererei pny-miR-1
    43. Rattus norvegicus (Norway rat) rno-miR-1b
    44. Salmo salar ssa-miR-1-3p
    45. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-1-P2_3p (mature (guide))
    46. Scyliorhinus torazame Sto-Mir-1-P2_3p (mature (guide))
    47. Strongylocentrotus purpuratus spu-miR-1
    48. Taeniopygia guttata tgu-miR-1-3p
    49. Takifugu rubripes fru-miR-1
    50. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-1
    51. Tor tambroides (Thai mahseer) miR-1
    52. Xenopus laevis (African clawed frog) xla-miR-1a-3p
    53. Xenopus tropicalis Xtr-Mir-1-P2_3p (mature (guide))