Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-1a-3p URS00001DC04F_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 8 databases (LncBase, ENA, PirBase, TarBase, RefSeq, MirGeneDB, miRBase, IntAct). Described in 50 papers. Mus musculus (house mouse) mmu-miR-1a-3p sequence is a product of mmu-miR-1a-3p, miR-1, miR-1a, mmu-miR-1a, Mir1a-1, Mir1a-2, miR-1a-3p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including -14 gene, 0610005M07Rik, 0610006A03Rik, 0610006F02Rik, 0610006H08Rik, 0610006H10Rik, 0610006J14Rik, 0610006N12Rik, 0610006O14Rik, 0610007G24Rik.

Interactions 5

According to IntAct, Mus musculus (house mouse) mmu-miR-1a-3p interacts with:

IntAct ID Participant Synonyms
EBI-16752168 intact:EBI-16752162 EBI-16752162 ENSMUST00000053317.11 mrna_bdnf-1
EBI-20621363 intact:EBI-20560979 EBI-20560979 ENSMUST00000051477.12 mrna_cdc42
EBI-20595912 intact:EBI-20595893 EBI-20595893 ENSMUST00000087328.3 mrna_hsp70
EBI-20638189 intact:EBI-20638192 EBI-20638192 ENSMUST00000102671.9 mrna_mpl1
EBI-20638845 Q8CJG0 A1A563 Ago2 Argonaute RISC catalytic component 2 EBI-528299 Eif2c2 Eukaryotic translation initiation factor 2C 2 Kiaa4215 Piwi/argonaute family protein meIF2C2 Protein slicer Q4VAB3 Q571J6 Q8CJG0 ago2_mouse

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAAUGUAAAGAAGUAUGUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 52 other species

    1. Alligator mississippiensis (American alligator) ami-miR-1a-3p
    2. Anolis carolinensis aca-miR-1a-3p
    3. Bos taurus bta-miR-1
    4. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-1-5p
    5. Branchiostoma floridae (Florida lancelet) bfl-miR-1-3p
    6. Callithrix jacchus cja-miR-1a
    7. Callorhinchus milii (elephant shark) eshark_mir-1_2
    8. Canis lupus familiaris (dog) Cfa-Mir-1-P2_3p (mature (guide))
    9. Capra hircus (goat) chi-miR-1
    10. Cavia porcellus cpo-miR-1a-3p
    11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P2_3p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-miR-1a-3p
    13. Columba livia (rock pigeon) cli-miR-1a-3p
    14. Crassostrea gigas (Pacific oyster) Cgi-Mir-1_3p (mature (guide))
    15. Cyprinus carpio ccr-miR-1
    16. Danio rerio (zebrafish) dre-miR-1
    17. Dasypus novemcinctus (nine-banded armadillo) dno-miR-1-3p
    18. Echinops telfairi Ete-Mir-1-P2_3p (mature (guide))
    19. Eptesicus fuscus efu-miR-1
    20. Equus caballus eca-miR-1
    21. Gadus morhua (Atlantic cod) gmo-miR-1-3p
    22. Gallus gallus (chicken) Gga-Mir-1-P2_3p (mature (guide))
    23. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-1
    24. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-1
    25. Homo sapiens hsa-miR-1-3p
    26. Lottia gigantea (owl limpet) lgi-miR-1
    27. Lytechinus variegatus lva-miR-1-3p
    28. Macaca mulatta (Rhesus monkey) mml-miR-1-3p
    29. Maylandia zebra mze-miR-1
    30. Melibe leonina mle-miR-1-3p
    31. Monodelphis domestica mdo-miR-1-3p
    32. Neolamprologus brichardi nbr-miR-1
    33. Ophiophagus hannah (king cobra) oha-miR-1b-3p
    34. Oreochromis niloticus oni-miR-1
    35. Ornithorhynchus anatinus (platypus) oan-miR-1a-3p
    36. Oryctolagus cuniculus (rabbit) ocu-miR-1-3p
    37. Pan troglodytes (chimpanzee) ptr-miR-1
    38. Paralichthys olivaceus pol-miR-1-3p
    39. Patiria miniata pmi-miR-1-3p
    40. Pongo pygmaeus ppy-miR-1
    41. Pteropus alecto (black flying fox) pal-miR-1-3p
    42. Pundamilia nyererei pny-miR-1
    43. Rattus norvegicus (Norway rat) rno-miR-1b
    44. Salmo salar ssa-miR-1-3p
    45. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-1-P2_3p (mature (guide))
    46. Scyliorhinus torazame Sto-Mir-1-P2_3p (mature (guide))
    47. Strongylocentrotus purpuratus spu-miR-1
    48. Taeniopygia guttata tgu-miR-1-3p
    49. Takifugu rubripes fru-miR-1
    50. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-1
    51. Tor tambroides (Thai mahseer) miR-1
    52. Xenopus laevis (African clawed frog) xla-miR-1a-3p
    53. Xenopus tropicalis Xtr-Mir-1-P2_3p (mature (guide))