Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Arg (anticodon CCG) 1-1 (TRR-CCG1 1 to 3) secondary structure diagram

Homo sapiens (human) tRNA-Arg (anticodon CCG) 1-1 (TRR-CCG1 1 to 3) URS00001D909A_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCGCGUGGCCUAAUGGAUAAGGCGUCUGAUUCCGGAUCAGAAGAUUGAGGGUUCGAGUCCCUUCGUGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 49 other species

  1. Ailuropoda melanoleuca tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 3)
  2. Balaenoptera acutorostrata scammoni tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  3. Bos taurus tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 4)
  4. Callithrix jacchus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  5. Camelus ferus (Wild Bactrian camel) tRNA
  6. Canis lupus familiaris tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  7. Carlito syrichta tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  8. Cavia porcellus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  9. Ceratotherium simum simum tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 3)
  10. Chlorocebus sabaeus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  11. Choloepus hoffmanni tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  12. Cricetulus griseus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  13. Dasypus novemcinctus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  14. Dipodomys ordii tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  15. Echinops telfairi tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  16. Equus caballus tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 3)
  17. Erinaceus europaeus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  18. Felis catus tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 3)
  19. Gorilla gorilla gorilla tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  20. Ictidomys tridecemlineatus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  21. Macaca mulatta tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 3)
  22. Marmota monax (woodchuck) tRNA.Arg
  23. Mesocricetus auratus (golden hamster) tRNA
  24. Monodelphis domestica tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  25. Mus caroli tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  26. Mus musculus domesticus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  27. Mus musculus musculus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  28. Mus musculus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  29. Mus pahari tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  30. Mustela putorius furo tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 3)
  31. Neotoma lepida (desert woodrat) tRNA
  32. Nomascus leucogenys tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  33. Ochotona princeps tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1, tRNA-Arg-CCG-2-2)
  34. Oryctolagus cuniculus tRNA-Arg (CCG) (tRNA-Arg-CCG-2-1, tRNA-Arg-CCG-2-2)
  35. Otolemur garnettii tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  36. Ovis aries tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 3)
  37. Pan troglodytes tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 4)
  38. Papio anubis tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 3)
  39. Pongo abelii tRNA-Arg (CCG) (tRNA-Arg-CCG-1-2, tRNA-Arg-CCG-1-3, tRNA-Arg-CCG-1-5)
  40. Procavia capensis tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  41. Rattus norvegicus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  42. Saimiri boliviensis boliviensis tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  43. Sarcophilus harrisii tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  44. Sorex araneus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  45. Sus scrofa tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 3)
  46. Trichechus manatus latirostris tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-1-2)
  47. Tupaia chinensis (Chinese tree shrew) tRNA
  48. Tursiops truncatus tRNA-Arg (CCG) (tRNA-Arg-CCG-1-1)
  49. Vicugna pacos tRNA-Arg (CCG) (tRNA-Arg-CCG-1 1 to 3)
2D structure Publications