Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) microRNA dme-mir-317 precursor secondary structure diagram

Drosophila melanogaster (fruit fly) microRNA dme-mir-317 precursor URS00001D6BCF_7227

Automated summary: This pre miRNA sequence is 92 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (ENA, miRBase, FlyBase, RefSeq). Described in 17 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-317, RF00720). Drosophila melanogaster (fruit fly) microRNA dme-mir-317 precursor sequence is a product of dme-mir-317 precursor, 317 precursor RNA, mir-317, 317 precursor RN, FBgn0262378, 317, mir-317 precurso, mir-317 precursor, mir-317 precursor RNA genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUGCAACUGCCAUUGGGAUACACCCUGUGCUCGCUUUGAAUGAAAUGCAAGCAAGUGAACACAGCUGGUGGUAUCCAGUGGCCGUUUGGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 1 other species

    1. Drosophila sechellia microRNA dse-mir-317 precursor
    2. Drosophila simulans microRNA dsi-mir-317 precursor
    2D structure New