Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-126-5p URS00001D69F6_9031

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, miRBase, RefSeq, MirGeneDB). Described in 6 papers. Gallus gallus (chicken) gga-miR-126-5p sequence is a product of miR-126, gga-miR-126, MIR126, gga-miR-126-5p, miR-126-5p genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAUUAUUACUUUUGGUACGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 71 other species

    1. Alligator mississippiensis ami-miR-126-5p
    2. Anolis carolinensis aca-miR-126-5p
    3. Bos taurus (cattle) bta-miR-126-5p
    4. Canis lupus familiaris cfa-miR-126
    5. Cavia porcellus (domestic guinea pig) Cpo-Mir-126-v1_5p (mature (guide))
    6. Cervus elaphus (red deer) cel-miR-126*
    7. Chiloscyllium plagiosum microRNA cpl-miR-126*
    8. Chrysemys picta bellii Cpi-Mir-126-v1_5p (mature (guide))
    9. Chrysemys picta (Painted turtle) cpi-miR-126-5p
    10. Columba livia (rock pigeon) Cli-Mir-126-v1_5p (mature (guide))
    11. Cyprinus carpio ccr-miR-126-5p
    12. Danio rerio (zebrafish) dre-miR-126b-5p
    13. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-126-v1_5p (mature (guide))
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-126-v1_5p (mature (guide))
    15. Equus caballus (horse) eca-miR-126-5p
    16. Gadus morhua gmo-miR-126-5p
    17. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-126-5p
    18. Homo sapiens hsa-miR-126-5p
    19. Ictalurus punctatus (channel catfish) ipu-miR-126b
    20. Macaca mulatta Mml-Mir-126-v1_5p (mature (guide))
    21. Maylandia zebra mze-miR-126
    22. Microcebus murinus mmr-miR-126
    23. Monodelphis domestica mdo-miR-126-5p
    24. Mus musculus (house mouse) mmu-miR-126a-5p
    25. Neolamprologus brichardi nbr-miR-126
    26. Nomascus leucogenys nle-miR-126
    27. Oreochromis niloticus oni-miR-126
    28. Ornithorhynchus anatinus oan-miR-126-5p
    29. Oryzias latipes (Japanese medaka) ola-miR-126-5p
    30. Pundamilia nyererei pny-miR-126
    31. Python bivittatus pbv-miR-126-5p
    32. Rattus norvegicus rno-miR-126a-5p
    33. Salmo salar (Atlantic salmon) ssa-miR-126-5p
    34. Sarcophilus harrisii Sha-Mir-126-v1_5p* (star (passenger))
    35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-126-v1_5p (mature (guide))
    36. Sus scrofa ssc-miR-126-5p
    37. Taeniopygia guttata (zebra finch) Tgu-Mir-126-v1_5p (mature (guide))
    38. Tor tambroides miR-126b-5p
    39. Xenopus laevis (African clawed frog) xla-miR-126-5p
    40. Xenopus tropicalis xtr-miR-126-5p