Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata aly-miR396b-5p URS00001D441B_59689

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Arabidopsis lyrata. Annotated by 2 databases (ENA, miRBase). Described in 1 paper. Arabidopsis lyrata aly-miR396b-5p sequence is a product of aly-miR396b, miR396b, miR396, aly-miR396b-5p, miR396b-5p genes. Found in the Arabidopsis lyrata reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCCACAGCUUUCUUGAACUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 58 other species

    1. Aegilops tauschii ata-miR396c-5p
    2. Amborella trichopoda atr-miR396e
    3. Ananas comosus (pineapple) sbi-miR396c
    4. Aquilegia coerulea aqc-miR396b
    5. Arabidopsis thaliana ath-miR396b-5p
    6. Avicennia marina ama-miR396-5p
    7. Brachypodium distachyon (stiff brome) bdi-miR396e-5p
    8. Brassica napus bna-miR396a
    9. Brassica rapa (field mustard) bra-miR396-5p
    10. Bruguiera cylindrica bcy-miR396b
    11. Bruguiera gymnorhiza bgy-miR396b
    12. Camelina sativa (false flax) cas-miR396b
    13. Citrus clementina ccl-miR396
    14. Citrus sinensis (sweet orange) csi-miR396f-5p
    15. Corchorus capsularis (jute) sRNA CCACVL1_27830
    16. Corchorus olitorius aau-miR3
    17. Cucumis melo cme-miR396d
    18. Cynara cardunculus cca-miR396a-5p
    19. Fragaria vesca subsp. vesca fve-miR396b-5p
    20. Glycine max gma-miR396b-5p
    21. Helianthus annuus sRNA HannXRQ_Chr04g0097915
    22. Hypericum perforatum Hyp-miR396
    23. Linum usitatissimum lus-miR396b
    24. Malus domestica (apple) mdm-miR396c
    25. Manihot esculenta (cassava) mes-miR396f
    26. Medicago truncatula mtr-miR396a-5p
    27. Nicotiana attenuata microRNA mir-396-like
    28. Nicotiana tabacum nta-miR396b
    29. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396c-5p
    30. Oryza sativa osa-miR396c-5p
    31. Pachycladon cheesemanii Pch-miR396b
    32. Pachycladon fastigiatum Pfa-miR396b
    33. Picea abies (Norway spruce) pab-miR396h
    34. Pinus taeda pta-miR396
    35. Populus tomentosa Pto-miR396d
    36. Populus trichocarpa ptc-miR396d
    37. Prunus persica (peach) ppe-miR396b
    38. Ricinus communis (castor bean) rco-miR396
    39. Rosa chinensis ath-miR396b-5p
    40. Solanum lycopersicum sly-miR396b
    41. Solanum tuberosum (potato) stu-miR396-5p
    42. Sorghum bicolor sbi-miR396c
    43. Theobroma cacao (cacao) tcc-miR396c
    44. Zea mays zma-miR396e-5p