Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Picea abies (Norway spruce) pab-miR396g URS00001D441B_3329

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Picea abies. Annotated by 1 database (miRBase).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUCCACAGCUUUCUUGAACUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 52 other species

    1. Aegilops tauschii ata-miR396c-5p
    2. Amborella trichopoda atr-miR396c
    3. Ananas comosus (pineapple) sbi-miR396c
    4. Aquilegia coerulea aqc-miR396b
    5. Arabidopsis lyrata aly-miR396b-5p
    6. Arabidopsis thaliana (thale cress) ath-miR396b-5p
    7. Avicennia marina ama-miR396-5p
    8. Brachypodium distachyon (stiff brome) bdi-miR396e-5p
    9. Brassica napus bna-miR396a
    10. Brassica rapa bra-miR396-5p
    11. Bruguiera cylindrica bcy-miR396b
    12. Bruguiera gymnorhiza bgy-miR396b
    13. Camelina sativa cas-miR396b
    14. Citrus clementina ccl-miR396
    15. Citrus sinensis csi-miR396f-5p
    16. Corchorus capsularis (jute) sRNA CCACVL1_27830
    17. Corchorus olitorius aau-miR3
    18. Cucumis melo cme-miR396d
    19. Cynara cardunculus cca-miR396a-5p
    20. Fragaria vesca subsp. vesca fve-miR396b-5p
    21. Glycine max (soybean) gma-miR396b-5p
    22. Helianthus annuus ath-miR396b-5p
    23. Hypericum perforatum Hyp-miR396
    24. Linum usitatissimum (flax) lus-miR396e
    25. Malus domestica (apple) mdm-miR396e
    26. Manihot esculenta (cassava) mes-miR396e
    27. Medicago truncatula (barrel medic) mtr-miR396a-5p
    28. Nicotiana attenuata microRNA mir-396-like
    29. Nicotiana tabacum nta-miR396c
    30. Oryza alta miR396c 5p
    31. Oryza australiensis miR396c 5p
    32. Oryza barthii miR396c 5p
    33. Oryza glaberrima (African rice) miR396c 5p
    34. Oryza minuta miR396c 5p
    35. Oryza nivara miR396c 5p
    36. Oryza rufipogon miR396c 5p
    37. Oryza sativa Indica Group (long-grained rice) miR396c 5p
    38. Oryza sativa Japonica Group miR396c 5p
    39. Oryza sativa (rice) osa-miR396c-5p
    40. Pachycladon cheesemanii Pch-miR396b
    41. Pachycladon fastigiatum Pfa-miR396b
    42. Pinus taeda (loblolly pine) pta-miR396
    43. Populus tomentosa Pto-miR396d
    44. Populus trichocarpa ptc-miR396d
    45. Prunus persica ppe-miR396b
    46. Ricinus communis rco-miR396
    47. Rosa chinensis ath-miR396b-5p
    48. Solanum lycopersicum (tomato) sly-miR396b
    49. Solanum tuberosum stu-miR396-5p
    50. Sorghum bicolor sbi-miR396c
    51. Theobroma cacao tcc-miR396c
    52. Zea mays zma-miR396e-5p