Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pachycladon cheesemanii Pch-miR396b URS00001D441B_106773

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Pachycladon cheesemanii. Annotated by 1 database (ENA). Described in 0 papers. Pachycladon cheesemanii Pch-miR396b sequence is a product of miR396, miR396b, Pch-miR396b genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCCACAGCUUUCUUGAACUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 58 other species

    1. Aegilops tauschii ata-miR396c-5p
    2. Amborella trichopoda atr-miR396e
    3. Ananas comosus (pineapple) sbi-miR396c
    4. Aquilegia coerulea aqc-miR396b
    5. Arabidopsis lyrata aly-miR396b-5p
    6. Arabidopsis thaliana ath-miR396b-5p
    7. Avicennia marina ama-miR396-5p
    8. Brachypodium distachyon (stiff brome) bdi-miR396e-5p
    9. Brassica napus bna-miR396a
    10. Brassica rapa (field mustard) bra-miR396-5p
    11. Bruguiera cylindrica bcy-miR396b
    12. Bruguiera gymnorhiza bgy-miR396b
    13. Camelina sativa (false flax) cas-miR396b
    14. Citrus clementina ccl-miR396
    15. Citrus sinensis (sweet orange) csi-miR396f-5p
    16. Corchorus capsularis (jute) sRNA CCACVL1_27830
    17. Corchorus olitorius aau-miR3
    18. Cucumis melo cme-miR396d
    19. Cynara cardunculus cca-miR396a-5p
    20. Fragaria vesca subsp. vesca fve-miR396b-5p
    21. Glycine max gma-miR396b-5p
    22. Helianthus annuus sRNA HannXRQ_Chr04g0097915
    23. Hypericum perforatum Hyp-miR396
    24. Linum usitatissimum lus-miR396b
    25. Malus domestica (apple) mdm-miR396c
    26. Manihot esculenta (cassava) mes-miR396f
    27. Medicago truncatula mtr-miR396a-5p
    28. Nicotiana attenuata microRNA mir-396-like
    29. Nicotiana tabacum nta-miR396b
    30. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396c-5p
    31. Oryza sativa osa-miR396c-5p
    32. Pachycladon fastigiatum Pfa-miR396b
    33. Picea abies (Norway spruce) pab-miR396h
    34. Pinus taeda pta-miR396
    35. Populus tomentosa Pto-miR396d
    36. Populus trichocarpa ptc-miR396d
    37. Prunus persica (peach) ppe-miR396b
    38. Ricinus communis (castor bean) rco-miR396
    39. Rosa chinensis ath-miR396b-5p
    40. Solanum lycopersicum sly-miR396b
    41. Solanum tuberosum (potato) stu-miR396-5p
    42. Sorghum bicolor sbi-miR396c
    43. Theobroma cacao (cacao) tcc-miR396c
    44. Zea mays zma-miR396e-5p