v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-133b-5p URS00001D1F70_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-133b: Mmu-mir-133b is a microRNA that has been studied in various contexts. It has been found to be highly expressed at E13.5 in the mouse molar [PMC4696248]. Mmu-mir-133b is implicated in cell differentiation and targets Runx2, which promotes osteogenesis and represses adipogenesis [PMC3319598]. It has also been observed to be upregulated in white adipose tissue (WAT) in response to high-fat diet (HFD) feeding [PMC3319598]. In addition, mmu-mir-133b has been found to be the most highly upregulated microRNA after proanthocyanin supplementation in mice [PMC3254631]. Mmu-mir-133b is a miRNA involved in cell differentiation and its expression can be modulated by various factors such as diet and supplementation [PMC3319598] [PMC3254631]. References: - [PMC4696248]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4696248/ - [PMC3319598]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3319598/ - [PMC3254631]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3254631/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUGGUCAAACGGAACCAAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Cavia porcellus cpo-miR-133b-5p
  2. Dasypus novemcinctus (nine-banded armadillo) dno-miR-133b-5p
  3. Gadus morhua (Atlantic cod) gmo-miR-133b-5p
  4. Monodelphis domestica (gray short-tailed opossum) mdo-miR-133b-5p
  5. Ornithorhynchus anatinus oan-miR-133b-5p
  6. Oryctolagus cuniculus ocu-miR-133b-5p
  7. Paralichthys olivaceus (Japanese flounder) pol-miR-133-5p
  8. Salmo salar ssa-miR-133b-5p
 Publications