v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) testis expressed transcript, Y-linked 9A (TTTY9A, TTTY9B) URS00001CF151_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TTTY9A: TTTY9A is a non-coding transcription unit located on the Y chromosome [PMC5816366]. The gene content in P6 contradicts the fitness argument, while the gene content in P4, including TTTY9A, supports it [PMC4554990]. In a study on sarcopenia, TTTY9A was found to be down-regulated in the sarcopenia group [PMC7762514]. The functional role of TTTY9A is evident from observations in infertile males with a deletion around the P4 palindrome that resulted in the loss of TTTY9A [PMC5816366]. Quantitative PCR was used to quantify DNA copy numbers of TTTY9A along with other genes such as BAGE and ZFY [PMC6375207]. The prevalence and concentration of PCR-positive target inserts were generally higher in fertile control patients compared to other groups, with significantly higher values observed for TTTY9A prevalence compared to fertile OE patients [PMC6375207].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AACAACAGCCCUGCUCUGGUCCCUCCAAAAGCCGACGAAUCCACACAAGACUAAAGAUGAAGAAGAGGACAACAAGCCCAGCUCUAAUCACACUCCAGAAGAUAACUAGUCUACGCACAGCCAAAACUUAAAAACUCAUCAGUCUUUCCCAGAGACAGAUUGAACUUCAAGGUAAAAGUGAAUUUUCAGAUGCGGACAAGCUAACUUCUAAGGAUUAUGAGUAAUUCGACUCAUCUUUUAAAUAUCCAGAAAACCUCAUUUUUAGUGAAAGAGUGGAGAUAAAAGAAUAUUAAGAGUCCAGAAACUGGUGUUCUGGCUGUGGCCCUGCCUUAGACUGUCUCACUUUGUAGUCACUUUAUGCAGGAAACGUGCCCGGGCAUCUUGAAAUGGAUGAGUUCUCUUCUGGAGAUAUGUCUCAUGUGUACGCAUAUCUGGAGAUAUGCCUCUUGUGGGUGCUGCUGCAGCUGCUGUGCCCAUCUCAUAUCAAUACCCAAGCUUUUCUCAUGACGAACCAGAUGACUCUUGGUAACCAGGUUUGCUCCCCAGCUUCUAAUUUCAAUAUGAUGAGAAGUUACAUAACAUUUACUCCUUUGUAAAGGUUUCUCUGUCAUCAGACAAAACUCUGAAUAGAAACCGGUGGGUAAUCCAGUGUACUGGUUUUUCCUAAUGUAUUUGGUACUAUAGUGUAUGAACCGAGAAUAAUCGAGUCAAGUGAAACCCCCUUUUCCAGUCAUAAAAUGUCUCAUUCAUUAUACUAAAAGGAGCUGUUCUUUUAAAAAAGCCUUCUUAUUUUUCUACUAAAUUUUUAGAUAAGUAUAACCUACUAUAUUCCUCAAAUCUAGGCUUACAUUUGAGAAGGGUAAGCUGUGUUUUUUCCUCCGAAGAGUUGGGCUGUGAUCUUUACAACGAGACGUCGUUUUUCCCAGCAUAUUUCUGUUUUCUACCUAAACAUUAAGAUACACAUUUUUCUAGGCAUUAGAAAUAGUACAAUAUUGCCUGUGGUCUUUCCAUUUGACACCUGUGGCUGGAAUAUAUGUGUCGCUCCAGAAUUUAUAUGUUGGAAUUUAAAUGCCCCUGUGUGAUAGAAUUAAAAAGUGGGGACUUUGGGAGGAGGUUAAGAGUGCAAUUAGAGACCUUAUAAAAGAACUCAAUGGAAGUAGCUAGGCUUUUUAGCCCUUCCACCAUUAGAGGACACUGUAUUUGUCCUCUCUGGAGAACACAGCAACAAGGUGCCAUCUUGGAAGAAGAGACCCACCUUCACCAGACAUUGGACCUAUUAGUGCCUUGAUCUUGGACUUCCCAGUGUCUAAAACUGUAAGAAAUUUAUUUCUUUCCAGUUUCAUAAGUUACCCAGUCCAAGGUACUGUGUUAUAGCAUCAGGAACAUACUGAGAUGGCAUAUUUAUUGUGGAAAUUUUGGUCCUCAUACUUAAUGAAUGGGCUUCAAGUAUUUCGUUAGUUUUUAAAAACAGGGCUCCUCCUUUACAAUUGAUCUCAUUUUUAUUUUUUAAAAGUUAGCUUUUACAACAUAGAACUGGAAAAAAUCUCUACUCAGACCUCUAGAGUGUCCUAGAUUUUGUGGCAGAAUCACUAUGGAUAAUUUAUAGGUGCUUGUGAUCUCAUCUGUGUAUUAUUUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications