Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-574-3p URS00001CF056_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-574: hsa-mir-574 is an oncogenic miRNA that is upregulated in colorectal cancer liver metastasis and negatively regulates the metastasis associated in colon cancer [PMC5260001]. It is part of a miRNA signature that includes hsa-let-7i, hsa-miR-34a, hsa-miR-185, and hsa-miR-31, which are downregulated in colorectal cancer liver metastasis [PMC5511817]. In various cancer types, including hepatocellular carcinoma (HCC), Burkitt lymphoma (BL), and breast cancer (BC), hsa-mir-574 has been found to be associated with overall survival and prognosis [PMC7467934] [PMC8473752]. It has also been shown to have a positive regulation function on smooth muscle cell proliferation and blood vessel morphogenesis through EDN1 [PMC4222264]. Additionally, hsa-mir-574 has been identified as one of the top-ranked miRNAs associated with colorectal cancer liver metastasis [PMC5260001]. In HCC patients, it is part of a miRNA signature that includes other miRNAs such as hsa-miR-550a, hsa-miR-518b, and hsa-miR-512 that are significantly associated with prognosis [PMC7467934]. Furthermore, it has been found to be significantly expressed in tumor samples compared to normal samples in HCC patients [PMC7467934]. Overall, the evidence suggests that hsa-mir-574 plays an important role in various cancers and may have potential as a prognostic marker.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACGCUCAUGCACACACCCACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus (cattle) Bta-Mir-574_3p (mature (guide))
  2. Canis lupus familiaris cfa-miR-574
  3. Cavia porcellus cpo-miR-574-3p
  4. Cricetulus griseus cgr-miR-574
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-574-3p
  6. Echinops telfairi Ete-Mir-574_3p (mature (co-guide))
  7. Gorilla gorilla gorilla ggo-miR-574 (MIR574)
  8. Gorilla gorilla (western gorilla) ggo-miR-574
  9. Macaca mulatta mml-miR-574
  10. Mus musculus mmu-miR-574-3p
  11. Oryctolagus cuniculus (rabbit) ocu-miR-574-3p
  12. Otolemur garnettii oga-miR-574
  13. Pan paniscus ppa-miR-574
  14. Pteropus alecto (black flying fox) pal-miR-574-3p
  15. Sus scrofa (pig) ssc-miR-574-3p
Publications