Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-574 URS00001CF056_9593

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACGCUCAUGCACACACCCACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus (cattle) Bta-Mir-574_3p (mature (guide))
  2. Canis lupus familiaris cfa-miR-574
  3. Cavia porcellus cpo-miR-574-3p
  4. Cricetulus griseus cgr-miR-574
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-574-3p
  6. Echinops telfairi Ete-Mir-574_3p (mature (co-guide))
  7. Gorilla gorilla gorilla ggo-miR-574 (MIR574)
  8. Homo sapiens hsa-miR-574-3p
  9. Macaca mulatta mml-miR-574
  10. Mus musculus mmu-miR-574-3p
  11. Oryctolagus cuniculus (rabbit) ocu-miR-574-3p
  12. Otolemur garnettii oga-miR-574
  13. Pan paniscus ppa-miR-574
  14. Pteropus alecto (black flying fox) pal-miR-574-3p
  15. Sus scrofa (pig) ssc-miR-574-3p
Publications