v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus alecto (black flying fox) pal-miR-574-3p URS00001CF056_9402

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Pteropus alecto. Annotated by 1 database (miRBase).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CACGCUCAUGCACACACCCACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Bos taurus Bta-Mir-574_3p (mature (guide))
    2. Canis lupus familiaris cfa-miR-574
    3. Cavia porcellus cpo-miR-574-3p
    4. Cricetulus griseus cgr-miR-574
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-574-3p
    6. Echinops telfairi Ete-Mir-574_3p (mature (co-guide))
    7. Gorilla gorilla (western gorilla) ggo-miR-574
    8. Homo sapiens hsa-miR-574-3p
    9. Macaca mulatta (Rhesus monkey) mml-miR-574
    10. Mus musculus mmu-miR-574-3p
    11. Oryctolagus cuniculus ocu-miR-574-3p
    12. Otolemur garnettii oga-miR-574
    13. Pan paniscus ppa-miR-574
    14. Sus scrofa (pig) ssc-miR-574-3p