Automated summary: This pre miRNA sequence is 97 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (ENA, FlyBase, RefSeq, miRBase). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-981, RF01926). Drosophila melanogaster (fruit fly) microRNA dme-mir-981 precursor sequence is a product of 981 precursor RN, dme-mir-981 precursor, mir-981 precurso, FBgn0262178, mir-981, 981 precursor RNA, mir-981 precursor, mir-981 precursor RNA genes. Found in the fruit fly reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AAACAUCCUCACUGAAGUCGGGUUUCGUUAGCAGCGGGCUGUUUUAAUAAAUUCAACAAGUUCGUUGUCGACGAAACCUGCAUGCUGUGUGGAAAAU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.