Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1527 tRNA-Pro secondary structure diagram

Saccharomyces cerevisiae YJM1527 tRNA-Pro URS00001CCBCA_1294383

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae YJM1527. Annotated by 1 database (ENA). Described in 1 paper. Has a conserved secondary structure or a structured region.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAGAUAGAAGCCAAAAGGUCAGGCGCUUUCUUUGGGAGAAAGACCUAGUUAGUUCGAGUCUAUCCUAUCUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 106 other species

    1. Saccharomyces arboricola tRNA-Pro
    2. Saccharomyces bayanus tRNA-Pro
    3. Saccharomyces cariocanus tRNA-Pro
    4. Saccharomyces cerevisiae (baker's yeast) tRNA-Pro
    5. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Pro
    6. Saccharomyces cerevisiae PE-2 tRNA-Pro
    7. Saccharomyces cerevisiae S288C tRNA-Pro
    8. Saccharomyces cerevisiae x Saccharomyces paradoxus tRNA-Pro
    9. Saccharomyces cerevisiae YJM1078 tRNA-Pro
    10. Saccharomyces cerevisiae YJM1083 tRNA-Pro
    11. Saccharomyces cerevisiae YJM1129 tRNA-Pro
    12. Saccharomyces cerevisiae YJM1133 tRNA-Pro
    13. Saccharomyces cerevisiae YJM1190 tRNA-Pro
    14. Saccharomyces cerevisiae YJM1199 tRNA-Pro
    15. Saccharomyces cerevisiae YJM1202 tRNA-Pro
    16. Saccharomyces cerevisiae YJM1208 tRNA-Pro
    17. Saccharomyces cerevisiae YJM1242 tRNA-Pro
    18. Saccharomyces cerevisiae YJM1244 tRNA-Pro
    19. Saccharomyces cerevisiae YJM1248 tRNA-Pro
    20. Saccharomyces cerevisiae YJM1250 tRNA-Pro
    21. Saccharomyces cerevisiae YJM1252 tRNA-Pro
    22. Saccharomyces cerevisiae YJM1273 tRNA-Pro
    23. Saccharomyces cerevisiae YJM1304 tRNA-Pro
    24. Saccharomyces cerevisiae YJM1307 tRNA-Pro
    25. Saccharomyces cerevisiae YJM1311 tRNA-Pro
    26. Saccharomyces cerevisiae YJM1326 tRNA-Pro
    27. Saccharomyces cerevisiae YJM1332 tRNA-Pro
    28. Saccharomyces cerevisiae YJM1336 tRNA-Pro
    29. Saccharomyces cerevisiae YJM1338 tRNA-Pro
    30. Saccharomyces cerevisiae YJM1341 tRNA-Pro
    31. Saccharomyces cerevisiae YJM1342 tRNA-Pro
    32. Saccharomyces cerevisiae YJM1355 tRNA-Pro
    33. Saccharomyces cerevisiae YJM1356 tRNA-Pro
    34. Saccharomyces cerevisiae YJM1381 tRNA-Pro
    35. Saccharomyces cerevisiae YJM1383 tRNA-Pro
    36. Saccharomyces cerevisiae YJM1385 tRNA-Pro
    37. Saccharomyces cerevisiae YJM1386 tRNA-Pro
    38. Saccharomyces cerevisiae YJM1387 tRNA-Pro
    39. Saccharomyces cerevisiae YJM1388 tRNA-Pro
    40. Saccharomyces cerevisiae YJM1389 tRNA-Pro
    41. Saccharomyces cerevisiae YJM1399 tRNA-Pro
    42. Saccharomyces cerevisiae YJM1400 tRNA-Pro
    43. Saccharomyces cerevisiae YJM1401 tRNA-Pro
    44. Saccharomyces cerevisiae YJM1402 tRNA-Pro
    45. Saccharomyces cerevisiae YJM1415 tRNA-Pro
    46. Saccharomyces cerevisiae YJM1417 tRNA-Pro
    47. Saccharomyces cerevisiae YJM1418 tRNA-Pro
    48. Saccharomyces cerevisiae YJM1419 tRNA-Pro
    49. Saccharomyces cerevisiae YJM1433 tRNA-Pro
    50. Saccharomyces cerevisiae YJM1434 tRNA-Pro
    51. Saccharomyces cerevisiae YJM1439 tRNA-Pro
    52. Saccharomyces cerevisiae YJM1443 tRNA-Pro
    53. Saccharomyces cerevisiae YJM1444 tRNA-Pro
    54. Saccharomyces cerevisiae YJM1447 tRNA-Pro
    55. Saccharomyces cerevisiae YJM1450 tRNA-Pro
    56. Saccharomyces cerevisiae YJM1460 tRNA-Pro
    57. Saccharomyces cerevisiae YJM1463 tRNA-Pro
    58. Saccharomyces cerevisiae YJM1477 tRNA-Pro
    59. Saccharomyces cerevisiae YJM1478 tRNA-Pro
    60. Saccharomyces cerevisiae YJM1479 tRNA-Pro
    61. Saccharomyces cerevisiae YJM1526 tRNA-Pro
    62. Saccharomyces cerevisiae YJM1549 tRNA-Pro
    63. Saccharomyces cerevisiae YJM1573 tRNA-Pro
    64. Saccharomyces cerevisiae YJM1574 tRNA-Pro
    65. Saccharomyces cerevisiae YJM1592 tRNA-Pro
    66. Saccharomyces cerevisiae YJM1615 tRNA-Pro
    67. Saccharomyces cerevisiae YJM189 tRNA-Pro
    68. Saccharomyces cerevisiae YJM193 tRNA-Pro
    69. Saccharomyces cerevisiae YJM195 tRNA-Pro
    70. Saccharomyces cerevisiae YJM244 tRNA-Pro
    71. Saccharomyces cerevisiae YJM248 tRNA-Pro
    72. Saccharomyces cerevisiae YJM270 tRNA-Pro
    73. Saccharomyces cerevisiae YJM271 tRNA-Pro
    74. Saccharomyces cerevisiae YJM320 tRNA-Pro
    75. Saccharomyces cerevisiae YJM326 tRNA-Pro
    76. Saccharomyces cerevisiae YJM428 tRNA-Pro
    77. Saccharomyces cerevisiae YJM450 tRNA-Pro
    78. Saccharomyces cerevisiae YJM451 tRNA-Pro
    79. Saccharomyces cerevisiae YJM453 tRNA-Pro
    80. Saccharomyces cerevisiae YJM456 tRNA-Pro
    81. Saccharomyces cerevisiae YJM470 tRNA-Pro
    82. Saccharomyces cerevisiae YJM541 tRNA-Pro
    83. Saccharomyces cerevisiae YJM554 tRNA-Pro
    84. Saccharomyces cerevisiae YJM555 tRNA-Pro
    85. Saccharomyces cerevisiae YJM627 tRNA-Pro
    86. Saccharomyces cerevisiae YJM681 tRNA-Pro
    87. Saccharomyces cerevisiae YJM682 tRNA-Pro
    88. Saccharomyces cerevisiae YJM683 tRNA-Pro
    89. Saccharomyces cerevisiae YJM689 tRNA-Pro
    90. Saccharomyces cerevisiae YJM693 tRNA-Pro
    91. Saccharomyces cerevisiae YJM789 tRNA-Pro
    92. Saccharomyces cerevisiae YJM969 tRNA-Pro
    93. Saccharomyces cerevisiae YJM972 tRNA-Pro
    94. Saccharomyces cerevisiae YJM975 tRNA-Pro
    95. Saccharomyces cerevisiae YJM978 tRNA-Pro
    96. Saccharomyces cerevisiae YJM981 tRNA-Pro
    97. Saccharomyces cerevisiae YJM984 tRNA-Pro
    98. Saccharomyces cerevisiae YJM987 tRNA-Pro
    99. Saccharomyces cerevisiae YJM990 tRNA-Pro
    100. Saccharomyces cerevisiae YJM993 tRNA-Pro
    101. Saccharomyces cerevisiae YJM996 tRNA-Pro
    102. Saccharomyces mikatae tRNA-Pro
    103. Saccharomyces paradoxus tRNA-Pro
    104. Saccharomyces pastorianus tRNA-Pro
    105. Saccharomyces pastorianus Weihenstephan 34/70 tRNA-Pro
    106. Saccharomyces uvarum tRNA-Pro
    2D structure New