Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4484 URS00001CC0F4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4484: Hsa-mir-4484 is a microRNA that has been studied in various contexts. It has been found to be upregulated in patients with ONIHL (Occupational Noise-Induced Hearing Loss) [PMC5769754]. It has also been identified as one of the most expressed miRNAs in extracellular vesicles [PMC7062641]. In a study on patients with systemic sclerosis (SSc), hsa-mir-4484 demonstrated the highest upregulation compared to healthy subjects [PMC6776520]. Bioinformatics analysis has identified potential target genes of hsa-mir-4484 that may be related to the pathology of SSc [PMC6776520]. Hsa-mir-4484 has also been found to be upregulated in saliva samples from patients with malignant pleural effusion (MPE) compared to other groups [PMC7481620]. In addition, hsa-mir-4484 is one of four microRNAs that aligns to the mitochondrial genome at specific positions [PMC3439422]. The diagnostic value of hsa-mir-4484, along with another microRNA, hsa-miR-3663-3p, has been evaluated for distinguishing MPE patients from other groups [PMC7481620]. The expression levels of hsa-mir-4484 and hsa-miR-3663-3p have also been correlated with overall survival in lung squamous cell carcinoma patients [PMC7481620]. These findings suggest that hsa-mir-4484 may have potential as a diagnostic and prognostic biomarker in various diseases.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGGCGGGAGAAGCCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications