Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C RNA of Unknown Function URS00001C9907_559292

  • 254 nucleotides
  • 3 databases (ENA, RefSeq, SGD)
  • Found in 22 species
  • ncRNA

Automated summary: This sRNA sequence is 254 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (RefSeq, SGD, ENA). Described in 4 papers. Saccharomyces cerevisiae S288C RNA of Unknown Function sequence is a product of RUF23 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCUAGGCAGAACGCCUAGUUUACACAGUGGGAGAAUGAGGAUAGGCCUCUGCCUACGGUACCUUCGAAUACAGGGAAAGUGGGAAGAGUGAGCUGCCGAAGUGAAAGAGGCUUACGCAUUUUUUCUUUGGGAAGCGGACGCAGGACUAAGCUCAUCAUUUUCGAAAAAAAAAGAAAGUUGGAGCCGGAAAGGAAUUGGGUGUUAAAAAUGUACGGGUGAAAAAAGUCUUAUUUUGUCUUAAAAGGGGUUCCCCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 21 other species

    1. Saccharomyces cerevisiae (baker's yeast) RUF23
    2. Saccharomyces cerevisiae PE-2 RUF23
    3. Saccharomyces cerevisiae YJM1129 RUF23
    4. Saccharomyces cerevisiae YJM1133 RUF23
    5. Saccharomyces cerevisiae YJM1202 RUF23
    6. Saccharomyces cerevisiae YJM1242 RUF23
    7. Saccharomyces cerevisiae YJM1244 RUF23
    8. Saccharomyces cerevisiae YJM1336 RUF23
    9. Saccharomyces cerevisiae YJM1355 RUF23
    10. Saccharomyces cerevisiae YJM1356 RUF23
    11. Saccharomyces cerevisiae YJM1383 RUF23
    12. Saccharomyces cerevisiae YJM1385 RUF23
    13. Saccharomyces cerevisiae YJM1415 RUF23
    14. Saccharomyces cerevisiae YJM1417 RUF23
    15. Saccharomyces cerevisiae YJM1477 RUF23
    16. Saccharomyces cerevisiae YJM193 RUF23
    17. Saccharomyces cerevisiae YJM244 RUF23
    18. Saccharomyces cerevisiae YJM271 RUF23
    19. Saccharomyces cerevisiae YJM320 RUF23
    20. Saccharomyces cerevisiae YJM541 RUF23
    21. Saccharomyces cerevisiae YJM681 RUF23