Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-423-5p URS00001C8A86_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (LncBase, ENA, MirGeneDB, miRBase, GeneCards, RefSeq, MalaCards, TarBase). Homo sapiens (human) hsa-miR-423-5p sequence is a product of hsa-miR-423-5p, miR-423, miR-423-5p, hsa-miR-423, HSA-MIR-RG-51, MIR423, MIR-RG-51 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 16A, 182-FIP, 19A, 20D7-FC4, 2PP2A, 4.1N, 6.3, 6.8PL, 82-FIP, A121.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGGGCAGAGAGCGAGACUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species

    1. Bos taurus bta-miR-423-5p
    2. Callithrix jacchus cja-miR-423-5p
    3. Canis lupus familiaris cfa-miR-423a
    4. Capra hircus (goat) chi-miR-423-5p
    5. Cavia porcellus cpo-miR-423-5p
    6. Cervus elaphus (red deer) cel-miR-423-5p
    7. Cricetulus griseus cgr-miR-423-5p
    8. Dasypus novemcinctus dno-miR-423-5p
    9. Echinops telfairi Ete-Mir-423_5p (mature (co-guide))
    10. Equus caballus (horse) eca-miR-423-5p
    11. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-12205
    12. Macaca mulatta (Rhesus monkey) mml-miR-423-5p
    13. Mus musculus mmu-miR-423-5p
    14. Oryctolagus cuniculus ocu-miR-423-5p
    15. Papio hamadryas pha-miR-423
    16. Pongo pygmaeus (Bornean orangutan) ppy-miR-423-5p
    17. Pteropus alecto (black flying fox) pal-miR-423-5p
    18. Rattus norvegicus Rno-Mir-423_5p (mature (co-guide))
    19. Sus scrofa (pig) ssc-miR-423-5p
    Publications New