Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-423-5p URS00001C8A86_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGGGCAGAGAGCGAGACUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Bos taurus bta-miR-423-5p
  2. Callithrix jacchus cja-miR-423-5p
  3. Canis lupus familiaris (dog) cfa-miR-423a
  4. Capra hircus chi-miR-423-5p
  5. Cavia porcellus cpo-miR-423-5p
  6. Cervus elaphus (red deer) cel-miR-423-5p
  7. Cricetulus griseus (Chinese hamster) cgr-miR-423-5p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-423_5p (mature (co-guide))
  9. Equus caballus (horse) eca-miR-423-5p
  10. Gallus gallus Gallus_gallus piRNA piR-gga-12205
  11. Homo sapiens hsa-miR-423-5p
  12. Macaca mulatta (Rhesus monkey) mml-miR-423-5p
  13. Mus musculus mmu-miR-423-5p
  14. Oryctolagus cuniculus (rabbit) ocu-miR-423-5p
  15. Papio hamadryas (hamadryas baboon) pha-miR-423
  16. Pongo pygmaeus ppy-miR-423-5p
  17. Pteropus alecto pal-miR-423-5p
  18. Rattus norvegicus Rno-Mir-423_5p (mature (co-guide))
  19. Sus scrofa ssc-miR-423-5p