Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-149-5p URS00001C770D_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (miRBase, TarBase, IntAct, GeneCards, MirGeneDB, LncBase, ENA, RefSeq, PSICQUIC, MalaCards). Described in 71 papers. Homo sapiens (human) hsa-miR-149-5p sequence is a product of hsa-miR-149, miR-149-5p, MIR149, hsa-miR-149-5p, miR-149 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 16E1BP, 2HOR0202, 4E-BP1, 4F2, 4F2HC, 4F5REL, 4T2HC, 53BP1, 7-60, 90K.

Interactions 23

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-149-5p interacts with:

Interaction id Participant Synonyms
EBI-25372275 intact:EBI-25372277 EBI-25372277 ENST00000361127 mrna_lrig2
EBI-25419870 intact:EBI-25419289 EBI-25419289 ENST00000376590 mrna_mthfr
URS00001C770D_9606-12 P01375 P01375
URS00001C770D_9606-0 P01375 P01375
URS00001C770D_9606-13 P01584 P01584
URS00001C770D_9606-1 P01584 P01584
URS00001C770D_9606-3 P05231 P05231
URS00001C770D_9606-4 P05231 P05231
URS00001C770D_9606-14 P05231 P05231
URS00001C770D_9606-15 P05231 P05231
URS00001C770D_9606-2 P05231 P05231
URS00001C770D_9606-5 P09651 P09651
URS00001C770D_9606-16 P09651 P09651
URS00001C770D_9606-17 P11362 P11362
URS00001C770D_9606-6 P11362 P11362
URS00001C770D_9606-7 P14780 P14780
URS00001C770D_9606-8 P35052 P35052
URS00001C770D_9606-18 P35052 P35052
URS00001C770D_9606-9 P35228 P35228
URS00001C770D_9606-19 P43116 P43116
URS00001C770D_9606-10 P43116 P43116
URS00001C770D_9606-11 P49593 P49593
URS00001C770D_9606-20 P49593 P49593

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCUGGCUCCGUGUCUUCACUCCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 25 other species

    1. Bos taurus (cattle) bta-miR-149-5p
    2. Canis lupus familiaris cfa-miR-149
    3. Cavia porcellus (domestic guinea pig) cpo-miR-149-5p
    4. Cervus elaphus (red deer) cel-miR-149
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-149-5p
    6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-149_5p (mature (guide))
    7. Eptesicus fuscus (big brown bat) efu-miR-149
    8. Equus caballus (horse) eca-miR-149
    9. Gorilla gorilla (western gorilla) ggo-miR-149
    10. Macaca mulatta mml-miR-149-5p
    11. Mus musculus (house mouse) mmu-miR-149-5p
    12. Oryctolagus cuniculus (rabbit) Ocu-Mir-149_5p (mature (guide))
    13. Pan troglodytes (chimpanzee) ptr-miR-149
    14. Pongo pygmaeus ppy-miR-149
    15. Rattus norvegicus rno-miR-149-5p
    16. Sus scrofa ssc-miR-149