Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-432 URS00001C406A_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-432: Oar-mir-432 is a microRNA that has been found to have a positive correlation with KRT83, indicating a potential interaction between the two [PMC5948824]. The target mRNAs of oar-mir-432 were predicted using three different predictive software, namely RNAhybrid, TargetScan, and miRanda algorithm [PMC9087340]. The seed motif of oar-mir-432 was found to be mutated at the 3'-UTR site of BMP2 [PMC9087340]. In an experiment with preadipocytes, oar-mir-432 was transfected and resulted in downregulated expression levels of the marker gene PPAR-γ during adipogenesis [PMC9087340]. The expression trends of oar-mir-432 and SIRT1 were found to be contrasting at the RNA level [PMC10035661]. Additionally, both oar-mir-432 and KRT83 showed lower expression levels in adult compared to lamb [PMC5948824]. Furthermore, the expression of SIRT1 was inhibited by oar-mir-432 mimics as observed in Western blot analysis [PMC10035661]. References: [PMC5948824] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5948824/ [PMC9087340] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9087340/ [John et al., 2004] - https://pubmed.ncbi.nlm.nih.gov/15215398/ [Krüger and Rehmsmeier, 2006] - https://pubmed.ncbi.nlm.nih.gov/16787918/ [Agarwal et al., 2015] - https://pubmed.ncbi.nlm.nih.gov/25409818/ [PMC10035661] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10035661/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUGGAGUAGGUCAUUGGGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus bta-miR-432
  2. Callithrix jacchus cja-miR-432
  3. Canis lupus familiaris cfa-miR-432
  4. Capra hircus chi-miR-432-5p
  5. Cavia porcellus cpo-miR-432-5p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-432-5p
  7. Equus caballus eca-miR-432
  8. Homo sapiens hsa-miR-432-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-432-5p
  10. Oryctolagus cuniculus ocu-miR-432-5p
  11. Pan troglodytes (chimpanzee) ptr-miR-432
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-432
Publications