Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-432 URS00001C406A_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-432: Bta-mir-432 is a microRNA that has been found to have higher expression levels in mature testicular tissue [PMC8614260]. It has been shown to target ACTG1 and potentially activate the IGF2/AKT signaling pathway, promoting the proliferation and differentiation of myoblasts [PMC8759604]. Bta-mir-432 is differentially expressed in serum after MAP infection, with a 2-fold upregulation before infection and a 2-fold downregulation after 6 months of infection [PMC6600136] [PMC7242893]. It targets the RTL1 gene along with other miRNAs such as bta-miR-136, bta-miR-127, bta-miR-433, and bta-miR-431 [PMC8787201]. Bta-mir-432 has identical binding positions to hsa-miR-432 in the human RTL1 gene [PMC8787201]. It has also been found in bovine milk and colostrum along with other miRNAs such as bta-miR-135a, bta-miR-136, bta-miR-127, bta-miR431, and bta-mir433 [PMC8787201]. Bovine miRNAs including bta-mir432 have identical counterparts in humans as well [PMC8787201]. Bovine miRNAs including bta mir432 have binding sites that are fully complementary to human gene mRNAs [PMC8787201]. Additionally, it is found in a novel circular RNA along with other miRNAs such as let7a5p and let7e among others [PMC7230347]. BtamiRNA432 was initially identified through computer analysis of other animal sequences by Artzi et al. in 2008. In the AF library, bta-mir-432 had a high number of reads compared to the AM library [PMC4090223]. It is associated with GO terms related to lipid metabolism and adipogenesis [PMC4090223].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUGGAGUAGGUCAUUGGGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Callithrix jacchus cja-miR-432
  2. Canis lupus familiaris cfa-miR-432
  3. Capra hircus chi-miR-432-5p
  4. Cavia porcellus cpo-miR-432-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-432-5p
  6. Equus caballus eca-miR-432
  7. Homo sapiens hsa-miR-432-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-432-5p
  9. Oryctolagus cuniculus ocu-miR-432-5p
  10. Ovis aries oar-miR-432
  11. Pan troglodytes (chimpanzee) ptr-miR-432
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-432
Publications