Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-432 URS00001C406A_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-432: Eca-mir-432 is a miRNA that has been found to be influenced by the factor species and is part of a large miRNA cluster on equine chromosome 24 [PMC9873782] [PMC8699634]. It has been shown to have potential prognostic and diagnostic properties in equine sarcoid (ES) disease [PMC9873782]. In particular, eca-mir-432 has been identified as a potential biomarker for predicting the development of ES lesions in young male horses [PMC9873782]. It has also been found to have lower expression levels in horses with successful therapy compared to those where therapy failed [PMC9873782]. The specific biological functions of eca-mir-432 are still being investigated [PMC8699634]. Additionally, the expression of eca-mir-432 has been found to vary between male and female horses, with higher levels observed in males [PMC9873782] [PMC8699634]. However, it should be noted that the prognostic potential of eca-mir-432 for ES disease is limited to male horses and may not be applicable to females [PMC8699634]. Overall, eca-mir-432 shows promise as a biomarker for ES disease, but further research is needed to fully understand its role and potential applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUGGAGUAGGUCAUUGGGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus bta-miR-432
  2. Callithrix jacchus cja-miR-432
  3. Canis lupus familiaris cfa-miR-432
  4. Capra hircus chi-miR-432-5p
  5. Cavia porcellus cpo-miR-432-5p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-432-5p
  7. Homo sapiens hsa-miR-432-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-432-5p
  9. Oryctolagus cuniculus ocu-miR-432-5p
  10. Ovis aries oar-miR-432
  11. Pan troglodytes (chimpanzee) ptr-miR-432
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-432
Publications