Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-432-5p URS00001C406A_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUGGAGUAGGUCAUUGGGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus bta-miR-432
  2. Callithrix jacchus cja-miR-432
  3. Canis lupus familiaris cfa-miR-432
  4. Capra hircus chi-miR-432-5p
  5. Cavia porcellus cpo-miR-432-5p
  6. Equus caballus eca-miR-432
  7. Homo sapiens hsa-miR-432-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-432-5p
  9. Oryctolagus cuniculus ocu-miR-432-5p
  10. Ovis aries oar-miR-432
  11. Pan troglodytes (chimpanzee) ptr-miR-432
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-432