Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-296-5p URS00001C3AC1_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (TarBase, GeneCards, PSICQUIC, miRBase, MalaCards, LncBase, RefSeq, MirGeneDB, ENA). Homo sapiens (human) hsa-miR-296-5p sequence is a product of miR-296, hsa-miR-296, miR-296-5p, MIR296, hsa-miR-296-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 30K, 4832404P21Rik, 90K, A1A, A1AT, A2D, A2lp, AAAT, AACT, AAT.

Interactions 6

According to PSICQUIC, Homo sapiens (human) hsa-miR-296-5p interacts with:

Interaction id Participant Synonyms
URS00001C3AC1_9606-0 O14964 O14964
URS00001C3AC1_9606-3 O14964 O14964
URS00001C3AC1_9606-1 P08138 P08138
URS00001C3AC1_9606-4 P08138 P08138
URS00001C3AC1_9606-2 Q14790 Q14790
URS00001C3AC1_9606-5 Q14790 Q14790

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGGGCCCCCCCUCAAUCCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 6 other species

    1. Callithrix jacchus cja-miR-296
    2. Cavia porcellus cpo-miR-296-5p
    3. Macaca mulatta (Rhesus monkey) mml-miR-296-5p
    4. Mus musculus mmu-miR-296-5p
    5. Pongo pygmaeus (Bornean orangutan) ppy-miR-296-5p
    6. Rattus norvegicus rno-miR-296-5p
    Publications New