Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-301a-3p URS00001C11BC_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (TarBase, RefSeq, MirGeneDB, miRBase, MalaCards, LncBase, PSICQUIC, ENA, GeneCards). Described in 66 papers. Homo sapiens (human) hsa-miR-301a-3p sequence is a product of miR-301a, hsa-miR-301a, miR-301, miR-301a-3p, MIR301A, hsa-miR-301a-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 15E1.2, 182-FIP, 4EHP, 82-FIP, 9G8, A-myb, A214N16.3, A6, A8-51, AADACL1.

Interactions 2

According to PSICQUIC, Homo sapiens (human) hsa-miR-301a-3p interacts with:

Interaction id Participant Synonyms
URS00001C11BC_9606-0 P38936 P38936
URS00001C11BC_9606-1 P38936 P38936

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAGUGCAAUAGUAUUGUCAAAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 64 other species

    1. Alligator mississippiensis Ami-Mir-130-P2a_3p (mature (guide))
    2. Anolis carolinensis aca-miR-301a-3p
    3. Bos taurus (cattle) Bta-Mir-130-P2a_3p (mature (guide))
    4. Callithrix jacchus cja-miR-301a
    5. Callorhinchus milii (elephant shark) eshark_mir-130_2
    6. Canis lupus familiaris cfa-miR-301a
    7. Capra hircus chi-miR-301a-3p
    8. Cavia porcellus (domestic guinea pig) Cpo-Mir-130-P2a_3p (mature (guide))
    9. Cervus elaphus (red deer) Cel-miR-301a
    10. Chiloscyllium plagiosum microRNA cpl-miR-301
    11. Chrysemys picta bellii Cpi-Mir-130-P2a_3p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-miR-301a-3p
    13. Columba livia (rock pigeon) Cli-Mir-130-P2a_3p (mature (guide))
    14. Cricetulus griseus cgr-miR-301a-3p
    15. Cyprinus carpio ccr-miR-301a
    16. Danio rerio (zebrafish) Dre-Mir-130-P2a1_3p (mature (guide))
    17. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-130-P2a_3p (mature (guide))
    18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-130-P2a_3p (mature (guide))
    19. Equus caballus (horse) eca-miR-301a
    20. Gallus gallus (chicken) Gga-Mir-130-P2a_3p (mature (guide))
    21. Gorilla gorilla (western gorilla) ggo-miR-301a
    22. Ictalurus punctatus (channel catfish) ipu-miR-301a
    23. Macaca mulatta mml-miR-301a-3p
    24. Microcebus murinus mmr-miR-301a
    25. Monodelphis domestica mdo-miR-301-3p
    26. Mus musculus (house mouse) mmu-miR-301a-3p
    27. Nomascus leucogenys nle-miR-301a
    28. Ornithorhynchus anatinus oan-miR-301-3p
    29. Oryctolagus cuniculus (rabbit) Ocu-Mir-130-P2a_3p (mature (guide))
    30. Otolemur garnettii oga-miR-301a
    31. Pan troglodytes (chimpanzee) ptr-miR-301a
    32. Pongo pygmaeus ppy-miR-301a
    33. Python bivittatus pbv-miR-301a-3p
    34. Rattus norvegicus rno-miR-301a-3p
    35. Salmo salar (Atlantic salmon) ssa-miR-301d-3p
    36. Scyliorhinus torazame (cloudy catshark) Sto-Mir-130-P2b_3p (mature (co-guide))
    37. Taeniopygia guttata (zebra finch) tgu-miR-301-3p
    38. Xenopus tropicalis xtr-miR-301