Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-301a-3p URS00001C11BC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-301a: Hsa-mir-301a is a microRNA that has been studied in various contexts. It has been used in experiments involving plasmids LV3-pGLV-H1-GFP + Puro to investigate its inhibitory effects [PMC4304202]. In the field of miRNA normalization, hsa-mir-301a has been recommended as a reference gene pair for the normalization of miRNAs in primary MB specimens [PMC3531299]. In pancreatic cancer, high expression of hsa-mir-301a has been found to be beneficial [PMC8821103]. Furthermore, hsa-mir-301a is one of the miRNAs that showed significant prognostic value for colorectal cancer [PMC7344331]. It has also been identified as one of the miRNAs that are dysregulated in the development of Th17 cells [PMC5295180]. In this context, hsa-mir-301a was found to be down-regulated along with other miRNAs such as hsa-miR-20b, hsa-miR-21, hsa-miR-181a, and hsa-miR-210. Overall, these studies highlight the diverse roles and potential clinical significance of hsa-mir-301a in various diseases and biological processes.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAUAGUAUUGUCAAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Anolis carolinensis aca-miR-301a-3p
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-301a
  3. Callorhinchus milii Cmi-Mir-130-P2a_3p (mature (co-guide))
  4. Canis lupus familiaris (dog) cfa-miR-301a
  5. Capra hircus (goat) chi-miR-301a-3p
  6. Cervus elaphus (red deer) Cel-miR-301a
  7. Chiloscyllium plagiosum microRNA cpl-miR-301
  8. Chrysemys picta (Painted turtle) cpi-miR-301a-3p
  9. Cricetulus griseus (Chinese hamster) cgr-miR-301a-3p
  10. Cyprinus carpio ccr-miR-301a
  11. Equus caballus eca-miR-301a
  12. Gallus gallus Gallus_gallus piRNA piR-gga-397117
  13. Gekko japonicus Gja-Mir-130-P2b_3p (mature (guide))
  14. Gorilla gorilla gorilla ggo-miR-301a (MIR301A)
  15. Gorilla gorilla (western gorilla) ggo-miR-301a
  16. Ictalurus punctatus (channel catfish) ipu-miR-301a
  17. Macaca mulatta mml-miR-301a-3p
  18. Microcebus murinus (gray mouse lemur) mmr-miR-301a
  19. Monodelphis domestica mdo-miR-301-3p
  20. Mus musculus (house mouse) mmu-miR-301a-3p
  21. Nomascus leucogenys nle-miR-301a
  22. Ornithorhynchus anatinus oan-miR-301-3p
  23. Otolemur garnettii (small-eared galago) oga-miR-301a
  24. Pan troglodytes (chimpanzee) ptr-miR-301a
  25. Pongo pygmaeus (Bornean orangutan) ppy-miR-301a
  26. Python bivittatus (Burmese python) pbv-miR-301a-3p
  27. Rattus norvegicus (Norway rat) rno-miR-301a-3p
  28. Salmo salar (Atlantic salmon) ssa-miR-301d-3p
  29. Taeniopygia guttata (zebra finch) tgu-miR-301-3p
  30. Xenopus tropicalis xtr-miR-301
Publications